G100625


Basic Information

Item Value
gene id G100625
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 11629855 ~ 11630158 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU114483
GCTCATTCTTGGATTCTTTGTTCTTAATCCAGATCTTTCCCTGGGTCTGGGGGTCAATCAGCAAGGGAAATCTGGCAGCTTTTGTAACAATAATCCCATTCTGGATGGACAGGTCATCATTGGGCAGCCCCTGTAGGTTCCATTCGCTTACCGTGGGAGCGTCAATCAACATCTCGGTGAGATTCAGATTAGTCCTAAAAGGAATTTGGCGGGACTTCATTTCTCTTTGCCAATCAGTGAGAAGGAGGTTGCGGAACTCTTGGTTAAAAGGGCCCGAGTAGGACAGGAAGGCTGTAGCCAGCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU114483 True 304 lncRNA 0.48 1 11629855 11630158

Neighbor

gene id symbol gene type direction distance location
CI01000016_11353238_11464979 TRIO, TRIOB coding downstream 164876 11352733 ~ 11464979 (-)
CI01000016_11167265_11226409 COBL coding downstream 403446 11167265 ~ 11226409 (-)
CI01000016_11161373_11165449 NA coding downstream 464406 11159368 ~ 11165449 (-)
CI01000016_11034620_11091604 GRB10B, GRB10 coding downstream 538251 11034620 ~ 11091604 (-)
CI01000016_10989691_11026452 NA coding downstream 603403 10988377 ~ 11026452 (-)
CI01000016_11670870_11794943 ADCY2A coding upstream 40660 11670818 ~ 11795083 (-)
CI01000016_11866962_11874982 PAPD7 coding upstream 235826 11865984 ~ 11874982 (-)
CI01000016_11876020_11896223 ICE1 coding upstream 245334 11875492 ~ 11896223 (-)
CI01000016_11908468_11923802 PRPF3 coding upstream 277569 11907727 ~ 11925765 (-)
CI01000016_11938043_11946368 NA coding upstream 307289 11937447 ~ 11946561 (-)
G100621 NA non-coding downstream 2431 11627188 ~ 11627424 (-)
G100619 NA non-coding downstream 6625 11622980 ~ 11623230 (-)
G100616 NA non-coding downstream 12237 11617398 ~ 11617618 (-)
G100562 NA non-coding downstream 307028 11320886 ~ 11322827 (-)
G100491 NA non-coding downstream 329234 11277556 ~ 11300621 (-)
G100490 NA non-coding upstream 118031 11748189 ~ 11814102 (-)
G100488 NA non-coding upstream 131950 11762108 ~ 11785556 (-)
G100669 NA non-coding upstream 270484 11900642 ~ 11900861 (-)
G100670 NA non-coding upstream 270948 11901106 ~ 11901345 (-)
G100679 NA non-coding upstream 317063 11947221 ~ 11947828 (-)
G100190 NA other downstream 1577466 10051168 ~ 10052389 (-)
G99178 NA other downstream 1814900 9814361 ~ 9814955 (-)
CI01000016_09510177_09512196 ID4 other downstream 2117427 9509622 ~ 9512428 (-)
G98691 NA other downstream 2372244 9256102 ~ 9257611 (-)
G98679 NA other downstream 2389926 9234996 ~ 9239929 (-)

Expression


Co-expression Network