Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G100701

Basic Information

Item	Value
gene id	G100701
gene name	NA
gene type	non-coding
species	grasscarp (Ctenopharyngodon idella)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	CI01000016
NCBI id	null
chromosome length	12175457
location	11982076 ~ 11982307 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU114569
TGAACTATGGTCACTGTAGTAATGGTTTTTTGTTAAATAAACAAAATAACTGGTAAAAAAACCCCAAAACCTTAGTATTGATATTTTAATTTGAGTATCGATACTTTCAATACTCAACGTCAGTATCGATATATCGATACTTCATATCGATCTGCCCATCCCTAGTGACGGAAAAGATGGAACAGCGGGAATGGCGAGCCAGGTACACTTGTTGAAACGAAACGCAAAGTGG

Function

GO: NA

KEGG: NA

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU114569	True	232	lncRNA	0.37	1	11982076	11982307

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
CI01000016_11938043_11946368	NA	coding	downstream	35515	11937447 ~ 11946561 (-)
CI01000016_11908468_11923802	PRPF3	coding	downstream	56311	11907727 ~ 11925765 (-)
CI01000016_11876020_11896223	ICE1	coding	downstream	85853	11875492 ~ 11896223 (-)
CI01000016_11866962_11874982	PAPD7	coding	downstream	107094	11865984 ~ 11874982 (-)
CI01000016_11670870_11794943	ADCY2A	coding	downstream	186993	11670818 ~ 11795083 (-)
CI01000016_12116368_12123187	NA	coding	upstream	133995	12116302 ~ 12123298 (-)
CI01000016_12137876_12146233	NA	coding	upstream	155467	12137774 ~ 12147884 (-)
G100679	NA	non-coding	downstream	34248	11947221 ~ 11947828 (-)
G100670	NA	non-coding	downstream	80731	11901106 ~ 11901345 (-)
G100669	NA	non-coding	downstream	81215	11900642 ~ 11900861 (-)
G100490	NA	non-coding	downstream	167974	11748189 ~ 11814102 (-)
G100488	NA	non-coding	downstream	196520	11762108 ~ 11785556 (-)
G100712	NA	non-coding	upstream	17393	11999700 ~ 12000027 (-)
G100722	NA	non-coding	upstream	178448	12160755 ~ 12161232 (-)
G100190	NA	other	downstream	1929687	10051168 ~ 10052389 (-)
G99178	NA	other	downstream	2167121	9814361 ~ 9814955 (-)
CI01000016_09510177_09512196	ID4	other	downstream	2469648	9509622 ~ 9512428 (-)
G98691	NA	other	downstream	2724465	9256102 ~ 9257611 (-)
G98679	NA	other	downstream	2742147	9234996 ~ 9239929 (-)

Expression

Co-expression Network