CI01000018_05990359_05991280 (NDUFB4)


Basic Information

Item Value
gene id CI01000018_05990359_05991280
gene name NDUFB4
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000018
NCBI id null
chromosome length 7078422
location 5990296 ~ 5991404 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000018_05990359_05991280.mRNA
AGAACCCAGTACAGTAATCTTCTCTGGCGAGATATTCTGAAATACCGCGAGACTCGTGAACGTGACGCGGAGCCAATCGGATGTTTCCTTTCTTCTCGGGGCGTGTTGTTCGCCGTTCGCAAACATGGCGAACTACAAAGAGGCTCCTTTGGCTACACGGCCAAAAACTTTAGATCCAGCCGAATATTTCAATCTTTCACCTGATTACCGGCGGTCTGAGGAGGATAGAGCGGCTCTGCGGGCACGACTGAAGAGGCAGTATCTGTTGCAGCTAAATAATCCTCATCGGCAAGAGCTTATTGAGGATCCTGCTCTTACAAGGTGGACACATGCGCGTGGCAGTAACATCTACCCCAACTTCAGACCAACTGCTAAAACATCACTGATGGGCAGCTTGTTTGGAGTTTTACCTCTCTTCGTCTTGTACTTTGTCTTTAAGACAGACAGGGATAAAAGGGAGGCGAAGATGAAAGCAGGGACCTATGAGCGCCCCTATAAGCTGTCATCCTAAAATTGTTTTCTGATTTCACTGTTTATTGTAACAAATAGTACTTGTAATTATATATTAAATAAA

Function

symbol description
ndufb4 Predicted to enable NADH dehydrogenase (ubiquinone) activity. Predicted to be located in mitochondrial inner membrane. Predicted to be integral component of membrane. Is expressed in several structures, including adaxial cell; digestive system; lens; musculature system; and solid lens vesicle. Orthologous to human NDUFB4 (NADH:ubiquinone oxidoreductase subunit B4).

GO: NA

KEGG:

id description
K03960 NDUFB4; NADH dehydrogenase (ubiquinone) 1 beta subcomplex subunit 4

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000018_05990359_05991280.mRNA True 574 mRNA 0.45 3 5990296 5991404

Neighbor

gene id symbol gene type direction distance location
CI01000018_05969322_05974836 ARX, ARXA coding downstream 15295 5969289 ~ 5975001 (-)
CI01000018_05910381_05911415 RRS1 coding downstream 78881 5910118 ~ 5911415 (-)
CI01000018_05905787_05908656 NA coding downstream 81614 5905525 ~ 5908682 (-)
CI01000018_05870993_05880212 SGK3 coding downstream 109591 5870313 ~ 5880705 (-)
CI01000018_05864737_05869576 MCMDC2 coding downstream 120720 5864455 ~ 5869576 (-)
CI01000018_05992061_05992357 NA coding upstream 591 5991995 ~ 5992357 (-)
CI01000018_05993799_05995338 NA coding upstream 2337 5993741 ~ 5995338 (-)
CI01000018_05997348_06004889 NA coding upstream 5750 5997154 ~ 6004889 (-)
CI01000018_06021105_06025859 NA coding upstream 29457 6020861 ~ 6025876 (-)
CI01000018_06027217_06038423 NA coding upstream 35587 6026991 ~ 6038423 (-)
G106017 NA non-coding downstream 142737 5847345 ~ 5847559 (-)
G106013 NA non-coding downstream 190910 5799157 ~ 5799386 (-)
G105956 NA non-coding downstream 268447 5721518 ~ 5721849 (-)
G105948 NA non-coding downstream 293186 5696758 ~ 5697110 (-)
G105939 NA non-coding downstream 324208 5665853 ~ 5666088 (-)
G106077 NA non-coding upstream 51756 6043160 ~ 6043390 (-)
G106096 NA non-coding upstream 184028 6175432 ~ 6175649 (-)
G106477 NA non-coding upstream 261395 6252799 ~ 6253046 (-)
G106479 NA non-coding upstream 277063 6268467 ~ 6268704 (-)
G106498 NA non-coding upstream 389349 6380753 ~ 6383489 (-)
CI01000018_04856240_04875704 DAP other downstream 1114457 4855081 ~ 4876532 (-)
G105200 NA other downstream 1744286 4243467 ~ 4246010 (-)
G105104 NA other downstream 1972479 4007697 ~ 4017817 (-)
G104968 NA other downstream 2489782 3482104 ~ 3500514 (-)
CI01000018_02389202_02488018 CNTNAP2, CNTNAP2A other downstream 3589393 2389201 ~ 2488018 (-)
G106538 NA other upstream 539043 6530447 ~ 6533512 (-)
CI01000018_06639339_06649926 NA other upstream 649208 6639207 ~ 6649971 (-)

Expression


Co-expression Network