G103976



Basic Information


Item Value
gene id G103976
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000018
NCBI id null
chromosome length 7078422
location 2334697 ~ 2334901 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU118256
CACAGGTCATAACACCGTAGTCAAGGGCAGCTGGGAAATTGTAGAGTCTAGTGGACTGCACACTTGCTGAGGGTATCAGAGCTCCTGTTGAGGTTTGCTCTACTAGAATGGTGACTGACGTGAAGAGGTTACTGGGCCCGTTGTACAGGATAAACTGGACCATCACAATTTGGGTGAATGGTGTCATCCAGCTGGTATCCAGAAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU118256 True 205 lncRNA 0.49 1 2334697 2334901

Neighbor


gene id symbol gene type direction distance location
CI01000018_02282563_02282856 NA coding downstream 51625 2282554 ~ 2283072 (-)
CI01000018_02195642_02198053 SKIDA1 coding downstream 135297 2193361 ~ 2199400 (-)
CI01000018_02138741_02148435 ARMC3 coding downstream 186262 2138644 ~ 2148435 (-)
CI01000018_02135812_02137218 MSRB2 coding downstream 197479 2135750 ~ 2137218 (-)
CI01000018_02129101_02134686 C8G coding downstream 200011 2128393 ~ 2134686 (-)
CI01000018_02356445_02369996 CUL1B, CUL1A, MGC114992, CUL1.L, CUL1 coding upstream 21025 2355926 ~ 2370015 (-)
CI01000018_02381118_02382741 NA coding upstream 45997 2380898 ~ 2382749 (-)
CI01000018_02389202_02488018 CNTNAP2, CNTNAP2A coding upstream 54301 2389201 ~ 2488018 (-)
CI01000018_02537614_02606018 NA coding upstream 202609 2537510 ~ 2606161 (-)
CI01000018_02613387_02620287 CNTNAP2 coding upstream 278123 2613024 ~ 2620287 (-)
G103969 NA non-coding downstream 17615 2316858 ~ 2317082 (-)
G103967 NA non-coding downstream 25847 2308284 ~ 2308850 (-)
G103966 NA non-coding downstream 26977 2306337 ~ 2307720 (-)
G103965 NA non-coding downstream 29725 2304344 ~ 2304972 (-)
G103964 NA non-coding downstream 30641 2303840 ~ 2304056 (-)
G103859 NA non-coding upstream 4408 2339309 ~ 2343042 (-)
G103989 NA non-coding upstream 129221 2464122 ~ 2464384 (-)
G103991 NA non-coding upstream 149293 2484194 ~ 2484961 (-)
G103994 NA non-coding upstream 168355 2503256 ~ 2503471 (-)
G103995 NA non-coding upstream 176871 2511772 ~ 2512208 (-)
G103842 NA other downstream 374639 1959497 ~ 1960058 (-)
G104968 NA other upstream 1147203 3482104 ~ 3500514 (-)
G105104 NA other upstream 1672796 4007697 ~ 4017817 (-)
G105200 NA other upstream 1908566 4243467 ~ 4246010 (-)
CI01000018_04856240_04875704 DAP other upstream 2520180 4855081 ~ 4876532 (-)

Expression



Co-expression Network