G104025



Basic Information


Item Value
gene id G104025
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000018
NCBI id null
chromosome length 7078422
location 2785665 ~ 2785895 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU118311
TAGAAACACTCGTACACTGCCTGCTTCCAGTTCCTTTACACACACCACTTAAACCTAAAATAGTCATTCATAAATTTCGAAAAGGTTGAAGCGAATTACAAATCTTGCATCATAAAGCATTCTGAGCCAAGGTGCAAGTATATTTAAACACTTACATGACTCAGCCGAACGCATGAGCGCTGTCCAGCAGTCTTCTTCTTGAGCATTTGAGAGTGGGCAGTTAAAAACTAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU118311 True 231 lncRNA 0.40 1 2785665 2785895

Neighbor


gene id symbol gene type direction distance location
CI01000018_02613387_02620287 CNTNAP2 coding downstream 165378 2613024 ~ 2620287 (-)
CI01000018_02537614_02606018 NA coding downstream 179504 2537510 ~ 2606161 (-)
CI01000018_02389202_02488018 CNTNAP2, CNTNAP2A coding downstream 297647 2389201 ~ 2488018 (-)
CI01000018_02381118_02382741 NA coding downstream 402916 2380898 ~ 2382749 (-)
CI01000018_02356445_02369996 CUL1B, CUL1A, MGC114992, CUL1.L, CUL1 coding downstream 415650 2355926 ~ 2370015 (-)
CI01000018_02906370_02908615 NA coding upstream 120330 2906225 ~ 2908615 (-)
CI01000018_02910647_02918787 NA coding upstream 124536 2910431 ~ 2918787 (-)
CI01000018_02922931_02928062 NA coding upstream 136437 2922332 ~ 2928062 (-)
CI01000018_02931983_02940190 NA coding upstream 146031 2931926 ~ 2940420 (-)
CI01000018_02950311_03005969 KIAA1468 coding upstream 163952 2949847 ~ 3006204 (-)
G103996 NA non-coding downstream 271412 2513698 ~ 2514253 (-)
G103995 NA non-coding downstream 273457 2511772 ~ 2512208 (-)
G103994 NA non-coding downstream 282194 2503256 ~ 2503471 (-)
G103991 NA non-coding downstream 300704 2484194 ~ 2484961 (-)
G103989 NA non-coding downstream 321281 2464122 ~ 2464384 (-)
G104036 NA non-coding upstream 29532 2815427 ~ 2815653 (-)
G104069 NA non-coding upstream 123030 2908925 ~ 2909365 (-)
G104073 NA non-coding upstream 159651 2945546 ~ 2945745 (-)
G104084 NA non-coding upstream 319403 3105298 ~ 3105576 (-)
G103842 NA other downstream 825607 1959497 ~ 1960058 (-)
G104968 NA other upstream 696209 3482104 ~ 3500514 (-)
G105104 NA other upstream 1221802 4007697 ~ 4017817 (-)
G105200 NA other upstream 1457572 4243467 ~ 4246010 (-)
CI01000018_04856240_04875704 DAP other upstream 2069186 4855081 ~ 4876532 (-)
CI01000018_06021105_06025859 NA other upstream 3105441 6020861 ~ 6025876 (-)

Expression



Co-expression Network