G104069


Basic Information

Item Value
gene id G104069
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000018
NCBI id null
chromosome length 7078422
location 2908925 ~ 2909365 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU118356
TTTAAACAAAAAATATCTTAATTTGTGCTCCGAAGATCAACGAAGGTCTTACGGGTGTAAAACGGCACGAGGGTGAGTAATTAATGACAGAATTTTCATTTTTGGGTAAACTAACCCTTTAACTAACAATGAGCAATACAGTTCTAACATTATTAGTTTTTTAAAGTTAGTTAATAAAAATTAAACTGTTCATTGTTATTACCTATTAGCTCAGGACCATTAGGCCTAAATAATTGTAACAGATAGGCCTGATTTTAATAATGTATTAGTAAGCGTAAAAATTAACTAGCAATAAAAATGTAAATTGTTTAGATAAACAGTTTGCAAATTCGCTTTATATGTATAGCTACATAAGCCAAAAACAATCCTCACAGGCAGACCGACGGATAGATAACATGTCTACGACGCTTTATCTAGCTCTGCAGTAATGATGATGTGGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU118356 True 441 lncRNA 0.32 1 2908925 2909365

Neighbor

gene id symbol gene type direction distance location
CI01000018_02906370_02908615 NA coding downstream 310 2906225 ~ 2908615 (-)
CI01000018_02613387_02620287 CNTNAP2 coding downstream 288638 2613024 ~ 2620287 (-)
CI01000018_02537614_02606018 NA coding downstream 302764 2537510 ~ 2606161 (-)
CI01000018_02389202_02488018 CNTNAP2, CNTNAP2A coding downstream 420907 2389201 ~ 2488018 (-)
CI01000018_02381118_02382741 NA coding downstream 526176 2380898 ~ 2382749 (-)
CI01000018_02910647_02918787 NA coding upstream 1066 2910431 ~ 2918787 (-)
CI01000018_02922931_02928062 NA coding upstream 12967 2922332 ~ 2928062 (-)
CI01000018_02931983_02940190 NA coding upstream 22561 2931926 ~ 2940420 (-)
CI01000018_02950311_03005969 KIAA1468 coding upstream 40482 2949847 ~ 3006204 (-)
CI01000018_03035039_03102978 ARFGEF1 coding upstream 125284 3034649 ~ 3103604 (-)
G104036 NA non-coding downstream 93272 2815427 ~ 2815653 (-)
G104025 NA non-coding downstream 123030 2785665 ~ 2785895 (-)
G103996 NA non-coding downstream 394672 2513698 ~ 2514253 (-)
G103995 NA non-coding downstream 396717 2511772 ~ 2512208 (-)
G104073 NA non-coding upstream 36181 2945546 ~ 2945745 (-)
G104084 NA non-coding upstream 195933 3105298 ~ 3105576 (-)
G104099 NA non-coding upstream 265959 3175324 ~ 3202607 (-)
G104115 NA non-coding upstream 297015 3206380 ~ 3207820 (-)
G104121 NA non-coding upstream 309771 3219136 ~ 3264709 (-)
G103842 NA other downstream 948867 1959497 ~ 1960058 (-)
G104968 NA other upstream 572739 3482104 ~ 3500514 (-)
G105104 NA other upstream 1098332 4007697 ~ 4017817 (-)
G105200 NA other upstream 1334102 4243467 ~ 4246010 (-)
CI01000018_04856240_04875704 DAP other upstream 1945716 4855081 ~ 4876532 (-)
CI01000018_06021105_06025859 NA other upstream 2981971 6020861 ~ 6025876 (-)

Expression


Co-expression Network