G106013


Basic Information

Item Value
gene id G106013
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000018
NCBI id null
chromosome length 7078422
location 5799157 ~ 5799386 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU120511
TATAAAGTAGTCATTTTGACTATTCATTACATATGACGAGTTAAAAAAGCAATTGTACGACTTGAATACATAGTTGTCAGTGCTTAATTTACCAATTCCCATTGAATTCAATGACAAAAATTGGCCACTAGGTGTCATTAGAGGCGCATTGTAAATACAGCCCCTGCACTGATGGCTCTCATTGTGAGGAATTTCTAGTAAGAGTCTCCACAAATCTCACTTGATCTTTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU120511 True 230 lncRNA 0.36 1 5799157 5799386

Neighbor

gene id symbol gene type direction distance location
CI01000018_05667742_05668807 NA coding downstream 129917 5667619 ~ 5669240 (-)
CI01000018_05588289_05597432 NA coding downstream 201335 5587959 ~ 5597822 (-)
CI01000018_05528561_05576788 ZFHX4 coding downstream 222369 5528561 ~ 5576788 (-)
CI01000018_05472889_05494284 NA coding downstream 303787 5472651 ~ 5495370 (-)
CI01000018_05412935_05458370 NA coding downstream 340715 5412710 ~ 5458442 (-)
CI01000018_05803227_05816159 HNF4G coding upstream 3523 5802909 ~ 5816493 (-)
CI01000018_05820608_05821533 NA coding upstream 20524 5819910 ~ 5821533 (-)
CI01000018_05827740_05839214 PIGN coding upstream 28190 5827576 ~ 5839214 (-)
CI01000018_05864737_05869576 MCMDC2 coding upstream 65069 5864455 ~ 5869576 (-)
CI01000018_05870993_05880212 SGK3 coding upstream 70927 5870313 ~ 5880705 (-)
G105956 NA non-coding downstream 77308 5721518 ~ 5721849 (-)
G105948 NA non-coding downstream 102047 5696758 ~ 5697110 (-)
G105939 NA non-coding downstream 133069 5665853 ~ 5666088 (-)
G105526 NA non-coding downstream 305051 5493836 ~ 5494106 (-)
G105464 NA non-coding downstream 309422 5365050 ~ 5489735 (-)
G106017 NA non-coding upstream 47959 5847345 ~ 5847559 (-)
G106077 NA non-coding upstream 243774 6043160 ~ 6043390 (-)
G106096 NA non-coding upstream 376046 6175432 ~ 6175649 (-)
G106477 NA non-coding upstream 453413 6252799 ~ 6253046 (-)
G106479 NA non-coding upstream 469081 6268467 ~ 6268704 (-)
CI01000018_04856240_04875704 DAP other downstream 923318 4855081 ~ 4876532 (-)
G105200 NA other downstream 1553147 4243467 ~ 4246010 (-)
G105104 NA other downstream 1781340 4007697 ~ 4017817 (-)
G104968 NA other downstream 2298643 3482104 ~ 3500514 (-)
CI01000018_02389202_02488018 CNTNAP2, CNTNAP2A other downstream 3398254 2389201 ~ 2488018 (-)
CI01000018_06021105_06025859 NA other upstream 91950 6020861 ~ 6025876 (-)
G106538 NA other upstream 731061 6530447 ~ 6533512 (-)
CI01000018_06639339_06649926 NA other upstream 841226 6639207 ~ 6649971 (-)

Expression


Co-expression Network