CI01000020_05267250_05267668 (MRPS33)


Basic Information

Item Value
gene id CI01000020_05267250_05267668
gene name MRPS33
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 5267250 ~ 5268673 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000020_05267250_05267668.mRNA
TTGAAGATGGCAGGTCTTTCTAACTATGCCCTGCGCATGGCCCGTCTGAGCGCCCGAATATTTGGAGATGTGTCCCGTCACACAGACTCCAAGTCTATGAGAGTGGTAGGGTTTTTTAAAGAACCCCCTCTGGCCCAGAGAACAGAAGTCTATGACTGGTACCCCCCGCACAAGATTTACTATTCAATGACCCAGAAGCTCAGATATTTGGGGCTTTTCAGGGATGAGCACCAGGATTTCAAGGAGGAAATGAGACGCTTGAGGAAACTACGGGGGAAAGGAAAACCTAAGAAGGGAGAAGGGAAGAGAGCCACAAAGAAGAAGTAGACCAACGCATTTCAGCTATTTATGAACGGACACTTGAGAAACTGATGAAGAAACTGAGCTAAATACCTGTATGGACAACAGGACATTGCTAATGACAGTGGCAACATTACATCAGCAGAGATTATGGTGAAACAAAAAACAAACAAAACAGAAACATGATGTCTGTGATGGAAA

Function

symbol description
mrps33 Predicted to be located in ribosome. Predicted to be active in mitochondrion. Is expressed in otic vesicle and sensory system. Orthologous to human MRPS33 (mitochondrial ribosomal protein S33).

GO:

id name namespace
GO:0005840 ribosome cellular_component

KEGG:

id description
K17411 MRPS33; small subunit ribosomal protein S33

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000020_05267250_05267668.mRNA False 501 mRNA 0.45 2 5267250 5267842

Neighbor

gene id symbol gene type direction distance location
CI01000020_05143320_05161129 CNOT4B coding upstream 104491 5143173 ~ 5162759 (+)
CI01000020_05132989_05135436 NA coding upstream 131792 5132477 ~ 5135458 (+)
CI01000020_05108357_05112394 NA coding upstream 154698 5108279 ~ 5112552 (+)
CI01000020_05091059_05093805 RERGL, RERGLA coding upstream 172456 5091059 ~ 5094794 (+)
CI01000020_05038237_05069897 NA coding upstream 196937 5037139 ~ 5070313 (+)
CI01000020_05269653_05286461 BRAF coding downstream 1811 5269653 ~ 5287374 (+)
CI01000020_05309535_05312719 NA coding downstream 41693 5309535 ~ 5313384 (+)
CI01000020_05341186_05473274 BTBD11A, BTBD11B, BTBD11 coding downstream 73344 5341186 ~ 5473274 (+)
CI01000020_05475873_05481460 CYB5R3 coding downstream 208031 5475873 ~ 5481460 (+)
CI01000020_05490931_05500137 NA coding downstream 223089 5490931 ~ 5500137 (+)
G113975 NA non-coding upstream 66868 5179311 ~ 5200382 (+)
G113970 NA non-coding upstream 168887 5098142 ~ 5098363 (+)
G113058 NA non-coding upstream 323359 4940411 ~ 4943891 (+)
G113102 NA non-coding upstream 352979 4914021 ~ 4914271 (+)
G113955 NA non-coding downstream 27139 5294981 ~ 5299565 (+)
G113953 NA non-coding downstream 236122 5503964 ~ 5506516 (+)
G113932 NA non-coding downstream 298550 5566392 ~ 5622606 (+)
G113941 NA non-coding downstream 347461 5615303 ~ 5618949 (+)
CI01000020_04807118_04808453 NA other upstream 443464 4806765 ~ 4809414 (+)
CI01000020_04760482_04774849 NA other upstream 473989 4760012 ~ 4776083 (+)
G113050 NA other upstream 827488 4426658 ~ 4439762 (+)
G112753 NA other upstream 1533664 3714381 ~ 3733586 (+)
G112679 NA other upstream 1963520 3301171 ~ 3303730 (+)
G113929 NA other downstream 354865 5622707 ~ 5625232 (+)
G114094 NA other downstream 535210 5803052 ~ 5805718 (+)
CI01000020_05960777_05981596 NA other downstream 711919 5960777 ~ 5982298 (+)
G114382 NA other downstream 1324382 6592224 ~ 6593564 (+)
G114389 NA other downstream 1330504 6598346 ~ 6600180 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_028588 mrps33 coding NC_007115.7 CM002888.2 12102267 ~ 12106039 (-)