G110732


Basic Information

Item Value
gene id G110732
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 542600 ~ 543136 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU125818
CCAAAATAGCGTCACTTTTTAAATATAGTGGCTGAAAGACTGACATTCCCTTTATAACACCAGAACCTACCAGAACTACTACATCTACCCCAGACTGCGTTAGCAAATCCAGGCGGTATTTGTCATCTTCACGGGTGCCGATAGCAGCACCACACAACAGCTGTTTGCGAGAATCTTTGGAGGCCAGAGGATAGTCCCTGTTCTTCTTCAGGTCTGTGCGGGCTATTATGGCCACCAGTTCATCCTTGTCATTCACAATGGGCAGCTTACCTTTTTTTGCTGCGTTGCAGGATATCATTGGCCTCTTTCAGTGTGACACCAGCAGGAGCAACAACAAGATCCTCTCTTTTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU125818 True 351 lncRNA 0.46 2 542600 543136

Neighbor

gene id symbol gene type direction distance location
CI01000020_00536611_00538626 NA coding upstream 3618 534934 ~ 538982 (+)
CI01000020_00501322_00502978 LEPB coding upstream 39481 501190 ~ 503119 (+)
CI01000020_00466505_00489442 NA coding upstream 52936 466276 ~ 489664 (+)
CI01000020_00250359_00289375 SND1 coding upstream 253225 250359 ~ 289375 (+)
CI01000020_00126243_00220377 SND1 coding upstream 321140 126243 ~ 221460 (+)
CI01000020_00603718_00606833 NA coding downstream 60450 603586 ~ 607523 (+)
CI01000020_00621182_00624570 RAP1B, RAP1A coding downstream 78046 621182 ~ 625201 (+)
CI01000020_00631105_00635541 MCAT coding downstream 87969 631105 ~ 635541 (+)
CI01000020_00643857_00646974 CBLL1 coding downstream 100721 643857 ~ 647559 (+)
CI01000020_00701439_00712656 DEF6C coding downstream 158303 701439 ~ 712825 (+)
G110727 NA non-coding upstream 1522 453183 ~ 541078 (+)
G110663 NA non-coding upstream 133436 387647 ~ 409164 (+)
G110645 NA non-coding upstream 184769 357625 ~ 357831 (+)
G110641 NA non-coding upstream 189083 352907 ~ 353517 (+)
G110640 NA non-coding upstream 190475 351896 ~ 352125 (+)
G110780 NA non-coding downstream 10053 553189 ~ 553440 (+)
G110783 NA non-coding downstream 12903 556039 ~ 556269 (+)
G110714 NA non-coding downstream 15785 558921 ~ 560207 (+)
CI01000020_00752731_00769950 NA non-coding downstream 211317 752694 ~ 770027 (+)
G110741 NA non-coding downstream 344992 888128 ~ 888384 (+)
G110589 NA other upstream 315752 180778 ~ 226848 (+)
G110562 NA other upstream 494560 30693 ~ 48040 (+)
CI01000020_00810993_00815495 CDPF1 other downstream 267763 810899 ~ 816510 (+)
CI01000020_01083614_01106789 PLXNC1 other downstream 524920 1083230 ~ 1107257 (+)
CI01000020_01375811_01378288 AVPR2L other downstream 833233 1373164 ~ 1379068 (+)
CI01000020_02444149_02444833 NA other downstream 1901108 2443278 ~ 2444944 (+)
G111183 NA other downstream 2104375 2647511 ~ 2658913 (+)

Expression


Co-expression Network