G110742


Basic Information

Item Value
gene id G110742
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 974871 ~ 975583 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU125828
CTTCTGTGAGATACTGTATTTATGGTGGTTGGATGCATTTATTTTTGGCTTCAAAACAGGACCTCGCAGCCCCCACCCCTTCACCCCTGTTCACTATCATTATAAATCTTTGGAGAGCAAGGATATTAAATATAAGTCATATACACCTATGAATGGCATGAGGGTGAGTAAATCATGAGAATTTTCATTTTGGGGTGAACTATCCCTTTAATGCGCTGCTTTTGAAGCACACACATATACGTTACTCGCGCTGTACTCGCATCGGAGATCGCACACCAAACATTCTGGACCACAGAAACTTATCAACTGCCCCGCGACTTTTAATAAAATAGCTACTGAATCGCTACATTATATTTCTCAGCAACGAGGGGATAACATCGCTGGTTTTGAAGTAACTAAACTCAGAGCTTCGTTGTTAATAGAGAGACACTGAACAGACAAAGGTAACGTTAACTAATTCACACAACTCTCTCTCTCTCTTGACCTATAATGAATTCAAATAAATGCTATAATTCATTCAAGTAAAAGTAACCTTACGCACAACTTCATCTCTGTCTGATTCAAAGCAGGTAGAATGCTAGACCTAACAAGCCATAACTGACGAAAATATCCGTCATTTTTACCGTTTCCGGTCTAATATTGCGCTGCAAACATCAATAAGCAGCTTTAAGTTGTCAGTGCTGGCAAATAACCCTATAAGCGGGATAATTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU125828 True 713 lncRNA 0.40 1 974871 975583

Neighbor

gene id symbol gene type direction distance location
CI01000020_00959078_00971223 CRADD coding upstream 2872 959078 ~ 971999 (+)
CI01000020_00949140_00951237 SOCS2 coding upstream 22086 948756 ~ 952785 (+)
CI01000020_00934438_00935330 NA coding upstream 39515 934438 ~ 935356 (+)
CI01000020_00892454_00900973 RINT1 coding upstream 73820 892454 ~ 901051 (+)
CI01000020_00819154_00820506 NA coding upstream 153598 818849 ~ 821273 (+)
CI01000020_01083614_01106789 PLXNC1 coding downstream 107647 1083230 ~ 1107257 (+)
CI01000020_01120223_01142481 UHRF1BP1L coding downstream 144640 1120223 ~ 1142573 (+)
CI01000020_01147997_01150696 NA coding downstream 171962 1147545 ~ 1150963 (+)
CI01000020_01187688_01253805 NA coding downstream 211996 1187579 ~ 1254010 (+)
CI01000020_01275836_01316392 ANKS1B coding downstream 300253 1275836 ~ 1316392 (+)
G110822 NA non-coding upstream 4522 969393 ~ 970349 (+)
G110808 NA non-coding upstream 81698 892942 ~ 893173 (+)
G110741 NA non-coding upstream 86487 888128 ~ 888384 (+)
CI01000020_00752731_00769950 NA non-coding upstream 186245 752694 ~ 770027 (+)
G110714 NA non-coding upstream 414664 558921 ~ 560207 (+)
G110738 NA non-coding downstream 86 975669 ~ 976633 (+)
G110836 NA non-coding downstream 51861 1027444 ~ 1066165 (+)
G110743 NA non-coding downstream 81858 1057441 ~ 1068884 (+)
CI01000020_01375811_01378288 AVPR2L non-coding downstream 398874 1373164 ~ 1379068 (+)
G110891 NA non-coding downstream 404095 1379678 ~ 1379912 (+)
CI01000020_00810993_00815495 CDPF1 other upstream 158361 810899 ~ 816510 (+)
G110589 NA other upstream 748023 180778 ~ 226848 (+)
G110562 NA other upstream 926831 30693 ~ 48040 (+)
CI01000020_02444149_02444833 NA other downstream 1468661 2443278 ~ 2444944 (+)
G111183 NA other downstream 1671928 2647511 ~ 2658913 (+)
G112679 NA other downstream 2325588 3301171 ~ 3303730 (+)

Expression


Co-expression Network