G110909


Basic Information

Item Value
gene id G110909
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 1387609 ~ 1387903 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU126026
CTGTGTGTGGTTACCTGAATGATCTACGACTGTGTTTTTGTTTTGTGATGGTTGTTCAAGAGTCCCTTGTTTGTTCTGAGCAGTTAAACTGAGCTCTGTTCTTCAGAAAAATCCTCCAGGTCCTGCAGATTCTTCAGTTTTCTAGCATTTTTTGCATATTTGAACCCTTTACAGCAGTGACTGTATAATTTTGAGATCCATCTTTTCACACTGAAGACAATTGAGGGACTCAAACACAACTATTACAAAAGGTTCAAACAATCACTGATACTTTAGAAGGAAACACGATGCAGTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU126026 True 295 lncRNA 0.38 1 1387609 1387903

Neighbor

gene id symbol gene type direction distance location
CI01000020_01383268_01384854 DNAJB9B coding upstream 1568 1383268 ~ 1386041 (+)
CI01000020_01375811_01378288 AVPR2L coding upstream 8541 1373164 ~ 1379068 (+)
CI01000020_01341579_01343530 NA coding upstream 43563 1340893 ~ 1344046 (+)
CI01000020_01275836_01316392 ANKS1B coding upstream 71217 1275836 ~ 1316392 (+)
CI01000020_01187688_01253805 NA coding upstream 133599 1187579 ~ 1254010 (+)
CI01000020_01395424_01397266 SPIC coding downstream 7223 1395126 ~ 1397343 (+)
CI01000020_01400705_01401757 NA coding downstream 10393 1398296 ~ 1402082 (+)
CI01000020_01416902_01441420 MYBPC1 coding downstream 28999 1416902 ~ 1441556 (+)
CI01000020_01447228_01456657 CHPT1 coding downstream 58501 1446404 ~ 1457595 (+)
CI01000020_01484806_01488530 NA coding downstream 96713 1484616 ~ 1489015 (+)
G110908 NA non-coding upstream 68 1387338 ~ 1387541 (+)
G110892 NA non-coding upstream 7157 1380212 ~ 1380452 (+)
G110891 NA non-coding upstream 7697 1379678 ~ 1379912 (+)
G110743 NA non-coding upstream 318725 1057441 ~ 1068884 (+)
G110897 NA non-coding downstream 80281 1468184 ~ 1476360 (+)
G110928 NA non-coding downstream 91191 1479094 ~ 1479329 (+)
G110940 NA non-coding downstream 126778 1514681 ~ 1516164 (+)
G110950 NA non-coding downstream 149050 1536953 ~ 1538262 (+)
G110952 NA non-coding downstream 155130 1543033 ~ 1543255 (+)
CI01000020_01083614_01106789 PLXNC1 other upstream 300836 1083230 ~ 1107257 (+)
CI01000020_00810993_00815495 CDPF1 other upstream 571099 810899 ~ 816510 (+)
G110589 NA other upstream 1160761 180778 ~ 226848 (+)
G110562 NA other upstream 1339569 30693 ~ 48040 (+)
CI01000020_02444149_02444833 NA other downstream 1056341 2443278 ~ 2444944 (+)
G111183 NA other downstream 1259608 2647511 ~ 2658913 (+)
G112679 NA other downstream 1913268 3301171 ~ 3303730 (+)
G112753 NA other downstream 2326478 3714381 ~ 3733586 (+)
G113050 NA other downstream 3038755 4426658 ~ 4439762 (+)

Expression


Co-expression Network