G110928


Basic Information

Item Value
gene id G110928
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 1479094 ~ 1479329 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU126047
AAAAGTCGTTATTTTGTTTTTTTTGGCGCACAAACAATATTGTCACTTTATAATATTAAGGCAGAACCACTGAACTCACATGAACTGTTTTTAGTACCTTTATGGATCTTGAGAGAGGAAGTACCATTGCTGTCTATGTAGGCCTCACTGAGCCATCGGATTTAATCAAAAACACCTTAATTTGTGTTCCGAAGATGAACGAAGGTCTTACGGGTGTAGAACAACATGAGGGTGAG

Function

NR:

description
PREDICTED: mediator of RNA polymerase II transcription subunit 15 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU126047 True 236 lncRNA 0.38 1 1479094 1479329

Neighbor

gene id symbol gene type direction distance location
CI01000020_01447228_01456657 CHPT1 coding upstream 21499 1446404 ~ 1457595 (+)
CI01000020_01416902_01441420 MYBPC1 coding upstream 37538 1416902 ~ 1441556 (+)
CI01000020_01400705_01401757 NA coding upstream 77012 1398296 ~ 1402082 (+)
CI01000020_01395424_01397266 SPIC coding upstream 81751 1395126 ~ 1397343 (+)
CI01000020_01383268_01384854 DNAJB9B coding upstream 93053 1383268 ~ 1386041 (+)
CI01000020_01484806_01488530 NA coding downstream 5287 1484616 ~ 1489015 (+)
CI01000020_01500660_01504462 KLHL42 coding downstream 21331 1500660 ~ 1504827 (+)
CI01000020_01510968_01538886 NRIP2 coding downstream 30250 1509579 ~ 1539130 (+)
CI01000020_01585338_01604278 NA coding downstream 105535 1584864 ~ 1604586 (+)
CI01000020_01608261_01638242 NA coding downstream 128508 1607837 ~ 1638943 (+)
G110897 NA non-coding upstream 2734 1468184 ~ 1476360 (+)
G110909 NA non-coding upstream 91191 1387609 ~ 1387903 (+)
G110908 NA non-coding upstream 91553 1387338 ~ 1387541 (+)
G110892 NA non-coding upstream 98642 1380212 ~ 1380452 (+)
G110891 NA non-coding upstream 99182 1379678 ~ 1379912 (+)
G110940 NA non-coding downstream 35352 1514681 ~ 1516164 (+)
G110950 NA non-coding downstream 57624 1536953 ~ 1538262 (+)
G110952 NA non-coding downstream 63704 1543033 ~ 1543255 (+)
G110954 NA non-coding downstream 65803 1545132 ~ 1545347 (+)
G110962 NA non-coding downstream 96543 1575872 ~ 1576147 (+)
CI01000020_01375811_01378288 AVPR2L other upstream 100745 1373164 ~ 1379068 (+)
CI01000020_01083614_01106789 PLXNC1 other upstream 392321 1083230 ~ 1107257 (+)
CI01000020_00810993_00815495 CDPF1 other upstream 662584 810899 ~ 816510 (+)
G110589 NA other upstream 1252246 180778 ~ 226848 (+)
G110562 NA other upstream 1431054 30693 ~ 48040 (+)
CI01000020_02444149_02444833 NA other downstream 964915 2443278 ~ 2444944 (+)
G111183 NA other downstream 1168182 2647511 ~ 2658913 (+)
G112679 NA other downstream 1821842 3301171 ~ 3303730 (+)
G112753 NA other downstream 2235052 3714381 ~ 3733586 (+)
G113050 NA other downstream 2947329 4426658 ~ 4439762 (+)

Expression


Co-expression Network