G111028


Basic Information

Item Value
gene id G111028
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 1775994 ~ 1776484 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU126167
CTGGATTTGGTTTTCTGAGTCTTCTCTCCACAAACTGATGAAGGAATTGATTTCCGGCAGCACAGATGGGTCTGGACTGCCATCACAATGCATGTAACGCTCCCACTTAGCTTTGTTCCTGCATTCTGTTTCCCACTCAGTGACTGCAGAGTGATTCTCATCTAGAATCTGCCGCAGTTCATTCAGCTCGTCCTCTCTGCGCTCTCTGTCCTTTAACTCAAGTAGCTGTTGTTTCTCTTGTTCTATTCGCTCCCTCTCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU126167 True 259 lncRNA 0.47 3 1775994 1776484

Neighbor

gene id symbol gene type direction distance location
CI01000020_01745382_01768397 LRMP coding upstream 6975 1744756 ~ 1769019 (+)
CI01000020_01684414_01696762 PARPBP coding upstream 78898 1684414 ~ 1697096 (+)
CI01000020_01660231_01665929 PAH, TH2 coding upstream 109920 1660031 ~ 1666074 (+)
CI01000020_01647763_01658875 PAH coding upstream 116420 1647224 ~ 1659574 (+)
CI01000020_01608261_01638242 NA coding upstream 137051 1607837 ~ 1638943 (+)
CI01000020_01797763_01808798 NA coding downstream 21014 1797498 ~ 1808924 (+)
CI01000020_01947333_02011244 SOX5 coding downstream 170849 1947333 ~ 2011244 (+)
CI01000020_02079089_02081777 STRAP.L, STRAP coding downstream 302605 2079089 ~ 2081850 (+)
CI01000020_02083977_02102990 TMPOA coding downstream 307493 2083977 ~ 2103482 (+)
CI01000020_02105070_02110245 SLC25A3, SLC25A3A, SLC25A3B coding downstream 327742 2104226 ~ 2110319 (+)
G110967 NA non-coding upstream 50872 1715495 ~ 1725122 (+)
G110989 NA non-coding upstream 106138 1669440 ~ 1669856 (+)
G110962 NA non-coding upstream 199847 1575872 ~ 1576147 (+)
G110954 NA non-coding upstream 230647 1545132 ~ 1545347 (+)
G110952 NA non-coding upstream 232739 1543033 ~ 1543255 (+)
G111084 NA non-coding downstream 248186 2024670 ~ 2024915 (+)
G111044 NA non-coding downstream 287570 2064054 ~ 2070761 (+)
G111049 NA non-coding downstream 377316 2153800 ~ 2156087 (+)
G111038 NA non-coding downstream 452146 2228630 ~ 2229561 (+)
G111141 NA non-coding downstream 548784 2325268 ~ 2325492 (+)
CI01000020_01375811_01378288 AVPR2L other upstream 397645 1373164 ~ 1379068 (+)
CI01000020_01083614_01106789 PLXNC1 other upstream 689221 1083230 ~ 1107257 (+)
CI01000020_00810993_00815495 CDPF1 other upstream 959484 810899 ~ 816510 (+)
G110589 NA other upstream 1549146 180778 ~ 226848 (+)
G110562 NA other upstream 1727954 30693 ~ 48040 (+)
CI01000020_02444149_02444833 NA other downstream 667760 2443278 ~ 2444944 (+)
G111183 NA other downstream 871027 2647511 ~ 2658913 (+)
G112679 NA other downstream 1524687 3301171 ~ 3303730 (+)
G112753 NA other downstream 1937897 3714381 ~ 3733586 (+)
G113050 NA other downstream 2650174 4426658 ~ 4439762 (+)

Expression


Co-expression Network