G112702


Basic Information

Item Value
gene id G112702
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 3284701 ~ 3284907 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU128049
GTAAAAAATGGCTCTAATACACTCTTAAAAATAAAGGTTCCAAATGGTTTTTGGAACCGTTCTGTGAACAGTTCTTAAAAGAAACATTTGTTTCCCCTTAGTGTGAAGAATGAAGAATCTGAAGAACGTTTTGGTTCCATGGATCTCATGGAATCATCAGTGCCAATGAAGAACCTTTATTTTTAAGAATGTAGGCATGAAATAGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU128049 True 207 lncRNA 0.35 1 3284701 3284907

Neighbor

gene id symbol gene type direction distance location
CI01000020_03264878_03271412 NRF1 coding upstream 12632 3264117 ~ 3272069 (+)
CI01000020_03189213_03235363 NA coding upstream 49269 3188105 ~ 3235432 (+)
CI01000020_02983105_03176041 PLXNA4 coding upstream 108660 2983105 ~ 3176041 (+)
CI01000020_02865197_02919405 CHCHD3, CHCHD3A coding upstream 365296 2865197 ~ 2919405 (+)
CI01000020_02633932_02637797 MEST coding upstream 646695 2633932 ~ 2638006 (+)
CI01000020_03343617_03348546 KLHDC10 coding downstream 58710 3343617 ~ 3348555 (+)
CI01000020_03379393_03391963 SLC26A5 coding downstream 94486 3379393 ~ 3393102 (+)
CI01000020_03397866_03404516 PRDM4 coding downstream 112959 3397866 ~ 3404710 (+)
CI01000020_03405045_03408250 AKR1B1 coding downstream 120138 3405045 ~ 3408273 (+)
CI01000020_03623678_03625344 NA coding downstream 338627 3623534 ~ 3626024 (+)
G112699 NA non-coding upstream 22029 3262462 ~ 3262672 (+)
G112659 NA non-coding upstream 74989 3209440 ~ 3209712 (+)
G111287 NA non-coding upstream 216891 3029927 ~ 3067810 (+)
G111288 NA non-coding upstream 269809 3003380 ~ 3014892 (+)
G112687 NA non-coding downstream 18898 3303805 ~ 3304620 (+)
G112716 NA non-coding downstream 37916 3322823 ~ 3325360 (+)
G112681 NA non-coding downstream 52662 3337569 ~ 3338192 (+)
G112779 NA non-coding downstream 199121 3484028 ~ 3484228 (+)
G112782 NA non-coding downstream 201464 3486371 ~ 3486626 (+)
G111183 NA other upstream 625788 2647511 ~ 2658913 (+)
CI01000020_02444149_02444833 NA other upstream 834894 2443278 ~ 2444944 (+)
CI01000020_01375811_01378288 AVPR2L other upstream 1906352 1373164 ~ 1379068 (+)
CI01000020_01083614_01106789 PLXNC1 other upstream 2197928 1083230 ~ 1107257 (+)
CI01000020_00810993_00815495 CDPF1 other upstream 2468191 810899 ~ 816510 (+)
G112679 NA other downstream 16264 3301171 ~ 3303730 (+)
G112753 NA other downstream 429474 3714381 ~ 3733586 (+)
G113050 NA other downstream 1141751 4426658 ~ 4439762 (+)
CI01000020_04760482_04774849 NA other downstream 1475105 4760012 ~ 4776083 (+)
CI01000020_04807118_04808453 NA other downstream 1522120 4806765 ~ 4809414 (+)

Expression


Co-expression Network