G113254


Basic Information

Item Value
gene id G113254
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 3479345 ~ 3479635 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU128669
AGCAAGAGCAGTGTGAAGCAAATCCTTGAATCTTCACAGGAAGATTCAACACACTGGCTGCATCCGAAATCGCATACTCTCATGAGTAGGTACTTATTTTGAACAAGTACTTACTTTGTGAGCACTAAAAAAAGTACATTCTATATAGTATGAATGTGTGTATTATGAATGTAATCCAGATGTACTACATTCGCCATGTTGTCGTTATCATGTGACCTATCAGCGTCAGTTACGTTGCTTCACTGCCATTCACAAATCCTCACCCATGGCCTCATTGGAATTGGTGGCGAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU128669 True 291 lncRNA 0.40 1 3479345 3479635

Neighbor

gene id symbol gene type direction distance location
CI01000020_03429337_03436635 KIAA1644 coding downstream 42710 3429147 ~ 3436635 (-)
CI01000020_03409070_03412685 AKR1B1 coding downstream 66503 3408619 ~ 3412842 (-)
CI01000020_03393384_03396967 BRAFLDRAFT_126283, PSMC2 coding downstream 82378 3393384 ~ 3396967 (-)
CI01000020_03370073_03375747 TSPAN33, TSPAN33A coding downstream 103598 3369861 ~ 3375747 (-)
CI01000020_03362565_03367403 SMO coding downstream 111786 3362376 ~ 3367559 (-)
CI01000020_03511151_03514088 CMASA coding upstream 31441 3511076 ~ 3514088 (-)
CI01000020_03519363_03521659 KCNJ8, IRK8 coding upstream 39507 3519142 ~ 3521993 (-)
CI01000020_03524870_03559211 ABCC9 coding upstream 45180 3524815 ~ 3559804 (-)
CI01000020_03620476_03622801 NA coding upstream 140773 3620408 ~ 3623143 (-)
CI01000020_03627542_03627865 NA coding upstream 147857 3627492 ~ 3630498 (-)
G113249 NA non-coding downstream 6539 3472547 ~ 3472806 (-)
G113231 NA non-coding downstream 26407 3452620 ~ 3452938 (-)
G113160 NA non-coding downstream 33890 3391829 ~ 3445455 (-)
CI01000020_03304491_03309596 UBE2H non-coding downstream 174575 3300912 ~ 3310248 (-)
G113174 NA non-coding downstream 253793 3225240 ~ 3225552 (-)
G113256 NA non-coding upstream 4391 3484026 ~ 3484245 (-)
G113257 NA non-coding upstream 7310 3486945 ~ 3487299 (-)
G113259 NA non-coding upstream 13112 3492747 ~ 3493080 (-)
G113261 NA non-coding upstream 83834 3563469 ~ 3563675 (-)
G113286 NA non-coding upstream 108537 3588172 ~ 3594192 (-)
CI01000020_02828968_02849511 NA other downstream 629827 2828763 ~ 2849518 (-)
CI01000020_02121873_02122329 KISS2 other downstream 1356971 2121714 ~ 2122619 (-)
G112136 NA other downstream 1358113 2040034 ~ 2121232 (-)
CI01000020_01463785_01480876 GNPTAB other downstream 1994367 1463771 ~ 1481058 (-)
G113375 NA other upstream 281810 3761445 ~ 3847924 (-)
G113802 NA other upstream 1264884 4744519 ~ 4746050 (-)
G114747 NA other upstream 2044971 5524606 ~ 5525234 (-)
CI01000020_05958448_05959900 NA other upstream 2478816 5958221 ~ 5960015 (-)
G114926 NA other upstream 2679675 6159310 ~ 6162609 (-)

Expression


Co-expression Network