G112779


Basic Information

Item Value
gene id G112779
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 3484028 ~ 3484228 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU128134
CTAATGGCCTAACATGGTCGACATTGCAGAAAAACTACCATGTCAAGAACCTTTTGACTAAAATGTTTATTAGTTTCAGTGACATTTATTCATTCTTATTTAGTTTTTATTTAATTTTACTCAACAAACTCTCTGTTTAGTCTGTTTATGGGAAGGTTACAACTTTGATGTTCAACATATTGTTTCAGAAATGCAAACAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU128134 True 201 lncRNA 0.30 1 3484028 3484228

Neighbor

gene id symbol gene type direction distance location
CI01000020_03405045_03408250 AKR1B1 coding upstream 75755 3405045 ~ 3408273 (+)
CI01000020_03397866_03404516 PRDM4 coding upstream 79318 3397866 ~ 3404710 (+)
CI01000020_03379393_03391963 SLC26A5 coding upstream 90926 3379393 ~ 3393102 (+)
CI01000020_03343617_03348546 KLHDC10 coding upstream 135473 3343617 ~ 3348555 (+)
CI01000020_03264878_03271412 NRF1 coding upstream 211959 3264117 ~ 3272069 (+)
CI01000020_03623678_03625344 NA coding downstream 139306 3623534 ~ 3626024 (+)
CI01000020_03632947_03634207 NA coding downstream 148719 3632947 ~ 3634278 (+)
CI01000020_03660304_03682653 PLXNB2A coding downstream 176076 3660304 ~ 3683035 (+)
CI01000020_03761716_03806609 NELL2B coding downstream 277488 3761716 ~ 3806914 (+)
CI01000020_03840431_03846507 TWF1, TWF1B coding downstream 355374 3839602 ~ 3847229 (+)
G112681 NA non-coding upstream 145836 3337569 ~ 3338192 (+)
G112716 NA non-coding upstream 158668 3322823 ~ 3325360 (+)
G112687 NA non-coding upstream 179408 3303805 ~ 3304620 (+)
G112702 NA non-coding upstream 199121 3284701 ~ 3284907 (+)
G112699 NA non-coding upstream 221356 3262462 ~ 3262672 (+)
G112782 NA non-coding downstream 2143 3486371 ~ 3486626 (+)
G112785 NA non-coding downstream 8549 3492777 ~ 3493087 (+)
G112786 NA non-coding downstream 10021 3494249 ~ 3494964 (+)
G112788 NA non-coding downstream 11954 3496182 ~ 3496391 (+)
G112789 NA non-coding downstream 12847 3497075 ~ 3497332 (+)
G112679 NA other upstream 180298 3301171 ~ 3303730 (+)
G111183 NA other upstream 825115 2647511 ~ 2658913 (+)
CI01000020_02444149_02444833 NA other upstream 1034221 2443278 ~ 2444944 (+)
CI01000020_01375811_01378288 AVPR2L other upstream 2105679 1373164 ~ 1379068 (+)
CI01000020_01083614_01106789 PLXNC1 other upstream 2397255 1083230 ~ 1107257 (+)
G112753 NA other downstream 230153 3714381 ~ 3733586 (+)
G113050 NA other downstream 942430 4426658 ~ 4439762 (+)
CI01000020_04760482_04774849 NA other downstream 1275784 4760012 ~ 4776083 (+)
CI01000020_04807118_04808453 NA other downstream 1322799 4806765 ~ 4809414 (+)
CI01000020_05267250_05267668 MRPS33 other downstream 1782809 5267250 ~ 5268673 (+)

Expression


Co-expression Network