G112819


Basic Information

Item Value
gene id G112819
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 3746382 ~ 3746615 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU128175
GTTCTTTCAAAGCTTTGTCCTCCTTGAACATGACAGCGCACCTGATTCTGAGACATGTTCTGGTAAAATGGTAAAGTTCAGGCAGAAGCACTGGCCCCAGGCTGAGACTGAACTCTTTCTAACAGGAGGTCTTTCTGTCCTACTGTATGAAGAGTAACTTGTCATTATATGCAGAGGGCAAGCTAGAGACACACACAGCTCCCATCCAGAATACTCAAAGCCAGACGTAATTTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU128175 True 234 lncRNA 0.45 1 3746382 3746615

Neighbor

gene id symbol gene type direction distance location
CI01000020_03660304_03682653 PLXNB2A coding upstream 63347 3660304 ~ 3683035 (+)
CI01000020_03632947_03634207 NA coding upstream 112104 3632947 ~ 3634278 (+)
CI01000020_03623678_03625344 NA coding upstream 120358 3623534 ~ 3626024 (+)
CI01000020_03405045_03408250 AKR1B1 coding upstream 338109 3405045 ~ 3408273 (+)
CI01000020_03397866_03404516 PRDM4 coding upstream 341672 3397866 ~ 3404710 (+)
CI01000020_03761716_03806609 NELL2B coding downstream 15101 3761716 ~ 3806914 (+)
CI01000020_03840431_03846507 TWF1, TWF1B coding downstream 92987 3839602 ~ 3847229 (+)
CI01000020_03848839_03853256 PUS7L coding downstream 102224 3848839 ~ 3853630 (+)
CI01000020_03957225_03966342 PRICKLE1B, PRICKLE1 coding downstream 210610 3957225 ~ 3966942 (+)
CI01000020_03985890_03988606 ZCRB1 coding downstream 239275 3985890 ~ 3988936 (+)
G112806 NA non-coding upstream 32537 3713232 ~ 3713845 (+)
G112769 NA non-coding upstream 48874 3696585 ~ 3697508 (+)
G112760 NA non-coding upstream 50240 3689456 ~ 3696142 (+)
G112768 NA non-coding upstream 190433 3555249 ~ 3555949 (+)
G112766 NA non-coding upstream 229877 3516132 ~ 3516505 (+)
G112827 NA non-coding downstream 11246 3757861 ~ 3758199 (+)
G112848 NA non-coding downstream 111143 3857758 ~ 3858264 (+)
G112861 NA non-coding downstream 229256 3975871 ~ 3985375 (+)
G112897 NA non-coding downstream 246406 3993021 ~ 4051603 (+)
G112911 NA non-coding downstream 313286 4059901 ~ 4060168 (+)
G112753 NA other upstream 12796 3714381 ~ 3733586 (+)
G112679 NA other upstream 442652 3301171 ~ 3303730 (+)
G111183 NA other upstream 1087469 2647511 ~ 2658913 (+)
CI01000020_02444149_02444833 NA other upstream 1296575 2443278 ~ 2444944 (+)
CI01000020_01375811_01378288 AVPR2L other upstream 2368033 1373164 ~ 1379068 (+)
G113050 NA other downstream 680043 4426658 ~ 4439762 (+)
CI01000020_04760482_04774849 NA other downstream 1013397 4760012 ~ 4776083 (+)
CI01000020_04807118_04808453 NA other downstream 1060412 4806765 ~ 4809414 (+)
CI01000020_05267250_05267668 MRPS33 other downstream 1520422 5267250 ~ 5268673 (+)
G113929 NA other downstream 1876092 5622707 ~ 5625232 (+)

Expression


Co-expression Network