G112848


Basic Information

Item Value
gene id G112848
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 3857758 ~ 3858264 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU128206
AAATAATGGGTTAAGGGTGAACTAACCCTTTAATAAACAAAGACATTGCTCTATATTGCATATTCAACCTTTCAGTTGTAAAACAAAACTAAGAATCTTAGTTCTAGAAACTAGGGGTAGACTTATTAACAAACATGAATACAGTAAGAAAGACTATTACGTACAGTGACCCCACATCATCAGAAGTTAAAAGCCCTATTGCTTATTATTATACTTTATAAGCTTCATAAGAATCGTCTCCTTAGATTCACATTATAAAGGTAAGCAACAACTACTGATTCATCTGTTCTTCTGACAAGGGAGTTCAGAAATAGGGCAGCAGCATGTAAACATAGTCGAGCAGCATCACCCAGTGACTCCAGCAAAAGCATTAAAGCCATGCTTTGACATCAGAAGACATACATCCGTACAAACTTAATTAACAACTTAAATACAAATGAGGACTGTTATATTCTCCGTGATAGTGACTTTACAAAAGAAACGCACTTTATTTGTAAAGTTACTTAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU128206 True 507 lncRNA 0.34 1 3857758 3858264

Neighbor

gene id symbol gene type direction distance location
CI01000020_03848839_03853256 PUS7L coding upstream 4128 3848839 ~ 3853630 (+)
CI01000020_03840431_03846507 TWF1, TWF1B coding upstream 10529 3839602 ~ 3847229 (+)
CI01000020_03761716_03806609 NELL2B coding upstream 50844 3761716 ~ 3806914 (+)
CI01000020_03660304_03682653 PLXNB2A coding upstream 174723 3660304 ~ 3683035 (+)
CI01000020_03632947_03634207 NA coding upstream 223480 3632947 ~ 3634278 (+)
CI01000020_03957225_03966342 PRICKLE1B, PRICKLE1 coding downstream 98961 3957225 ~ 3966942 (+)
CI01000020_03985890_03988606 ZCRB1 coding downstream 127626 3985890 ~ 3988936 (+)
CI01000020_03989813_04001907 YAF2 coding downstream 131549 3989813 ~ 4002822 (+)
CI01000020_04005946_04011338 NA coding downstream 147475 4005739 ~ 4011483 (+)
CI01000020_04175433_04175851 AKAP14 coding downstream 317133 4175397 ~ 4175851 (+)
G112827 NA non-coding upstream 99559 3757861 ~ 3758199 (+)
G112819 NA non-coding upstream 111143 3746382 ~ 3746615 (+)
G112806 NA non-coding upstream 143913 3713232 ~ 3713845 (+)
G112769 NA non-coding upstream 160250 3696585 ~ 3697508 (+)
G112760 NA non-coding upstream 161616 3689456 ~ 3696142 (+)
G112861 NA non-coding downstream 117607 3975871 ~ 3985375 (+)
G112897 NA non-coding downstream 134757 3993021 ~ 4051603 (+)
G112911 NA non-coding downstream 201637 4059901 ~ 4060168 (+)
G112919 NA non-coding downstream 214158 4072422 ~ 4072638 (+)
G112928 NA non-coding downstream 232941 4091205 ~ 4100700 (+)
G112753 NA other upstream 124172 3714381 ~ 3733586 (+)
G112679 NA other upstream 554028 3301171 ~ 3303730 (+)
G111183 NA other upstream 1198845 2647511 ~ 2658913 (+)
CI01000020_02444149_02444833 NA other upstream 1407951 2443278 ~ 2444944 (+)
CI01000020_01375811_01378288 AVPR2L other upstream 2479409 1373164 ~ 1379068 (+)
G113050 NA other downstream 568394 4426658 ~ 4439762 (+)
CI01000020_04760482_04774849 NA other downstream 901748 4760012 ~ 4776083 (+)
CI01000020_04807118_04808453 NA other downstream 948763 4806765 ~ 4809414 (+)
CI01000020_05267250_05267668 MRPS33 other downstream 1408773 5267250 ~ 5268673 (+)
G113929 NA other downstream 1764443 5622707 ~ 5625232 (+)

Expression


Co-expression Network