G113065


Basic Information

Item Value
gene id G113065
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 4381021 ~ 4381313 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU128463
GTTAGTTCACCCAAAAATGAAAATTCTGTCATTAATTACTCACCCTTGTGCCGTTTTACACCCGTAAGACCTTCGTTGATCTTCGGAACACAAATTGAGATATTTTTGTTTAAATCCGATGGCTCCGTGAGGCCTACATAGGGAGCAATGACATTTCCTCTCTCAAGATCCATAAAGGTACTAAAAACATATTTAAATCAGTTCATGTGAGTACAGTGGTTCAATATTAATATTATAAAGCTACGAGAATATTTTTGGTGCGCCAAAAAAAACCAAAATAACGACTTATTTAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU128463 True 293 lncRNA 0.35 1 4381021 4381313

Neighbor

gene id symbol gene type direction distance location
CI01000020_04279888_04282279 NA coding upstream 98474 4279771 ~ 4282547 (+)
CI01000020_04273916_04275725 IFNG1-2 coding upstream 104914 4273738 ~ 4276107 (+)
CI01000020_04266512_04267515 NA coding upstream 113241 4266396 ~ 4267780 (+)
CI01000020_04240295_04242117 NA coding upstream 138648 4240191 ~ 4242373 (+)
CI01000020_04226010_04238699 MDM1 coding upstream 142098 4225042 ~ 4238923 (+)
CI01000020_04446676_04465745 NA coding downstream 62933 4444246 ~ 4466188 (+)
CI01000020_04496296_04500632 NA coding downstream 114808 4496121 ~ 4501039 (+)
CI01000020_04540238_04552388 NA coding downstream 157885 4539198 ~ 4552553 (+)
CI01000020_04593462_04636463 NA coding downstream 212149 4593462 ~ 4636472 (+)
CI01000020_04646413_04669776 GRIP1 coding downstream 264771 4646084 ~ 4670074 (+)
G113063 NA non-coding upstream 8787 4371891 ~ 4372234 (+)
G112935 NA non-coding upstream 157497 4222665 ~ 4223524 (+)
G112984 NA non-coding upstream 168100 4212678 ~ 4212921 (+)
G112982 NA non-coding upstream 170120 4210666 ~ 4210901 (+)
G112980 NA non-coding upstream 170932 4209627 ~ 4210089 (+)
G113067 NA non-coding downstream 21870 4403183 ~ 4408822 (+)
G113048 NA non-coding downstream 28199 4409512 ~ 4415205 (+)
G113060 NA non-coding downstream 203755 4585068 ~ 4591113 (+)
G113069 NA non-coding downstream 298976 4680289 ~ 4680672 (+)
G113057 NA non-coding downstream 312542 4693855 ~ 4701724 (+)
G112753 NA other upstream 647435 3714381 ~ 3733586 (+)
G112679 NA other upstream 1077291 3301171 ~ 3303730 (+)
G111183 NA other upstream 1722108 2647511 ~ 2658913 (+)
CI01000020_02444149_02444833 NA other upstream 1931214 2443278 ~ 2444944 (+)
CI01000020_01375811_01378288 AVPR2L other upstream 3002672 1373164 ~ 1379068 (+)
G113050 NA other downstream 45345 4426658 ~ 4439762 (+)
CI01000020_04760482_04774849 NA other downstream 378699 4760012 ~ 4776083 (+)
CI01000020_04807118_04808453 NA other downstream 425714 4806765 ~ 4809414 (+)
CI01000020_05267250_05267668 MRPS33 other downstream 885724 5267250 ~ 5268673 (+)
G113929 NA other downstream 1241394 5622707 ~ 5625232 (+)

Expression


Co-expression Network