G114060


Basic Information

Item Value
gene id G114060
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 5668649 ~ 5668857 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU129552
GACAAAGAGAGAGTGAGTGAATGAGAGTTGAGAACTCAGAGAAAGAGTGACAAGACAGAGAGAACCAAAATCTGGGTATAGTTAGCAGATTAATCCCAGCAGAACTCCTCAATATGGTTGCGTAACACCTTCAACGGCTCTCCTACACGCACATGTGCCCAGGCGTACAAACACTTCAGCATCTGTCCGCACAGTAGCTCATTGCGAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU129552 True 209 lncRNA 0.47 1 5668649 5668857

Neighbor

gene id symbol gene type direction distance location
CI01000020_05651021_05656758 NET1 coding upstream 11745 5650779 ~ 5656904 (+)
CI01000020_05636849_05648400 NA coding upstream 20227 5635351 ~ 5648422 (+)
CI01000020_05569133_05573180 NA coding upstream 94842 5568383 ~ 5573807 (+)
CI01000020_05536783_05538245 NA coding upstream 130263 5536783 ~ 5538386 (+)
CI01000020_05514885_05515490 NA coding upstream 152954 5514885 ~ 5515695 (+)
CI01000020_05816151_05820574 NA coding downstream 146806 5815663 ~ 5820886 (+)
CI01000020_05941404_05941840 NA coding downstream 272547 5941404 ~ 5941885 (+)
CI01000020_05942995_05951650 PRMT8B, PRMT8 coding downstream 273069 5941926 ~ 5952403 (+)
CI01000020_05960777_05981596 NA coding downstream 291920 5960777 ~ 5982298 (+)
CI01000020_05988468_05989551 NA coding downstream 319394 5988251 ~ 5989553 (+)
G113924 NA non-coding upstream 41026 5625923 ~ 5627623 (+)
G113932 NA non-coding upstream 46043 5566392 ~ 5622606 (+)
G113941 NA non-coding upstream 49700 5615303 ~ 5618949 (+)
G113953 NA non-coding upstream 162133 5503964 ~ 5506516 (+)
CI01000020_05490931_05500137 NA non-coding upstream 174582 5490931 ~ 5500137 (+)
G114070 NA non-coding downstream 41786 5710643 ~ 5710910 (+)
G113915 NA non-coding downstream 46806 5715663 ~ 5717142 (+)
G114084 NA non-coding downstream 114200 5783057 ~ 5783281 (+)
G114085 NA non-coding downstream 114659 5783516 ~ 5783743 (+)
G114117 NA non-coding downstream 178696 5847553 ~ 5847781 (+)
G113929 NA other upstream 43417 5622707 ~ 5625232 (+)
CI01000020_05267250_05267668 MRPS33 other upstream 399976 5267250 ~ 5268673 (+)
CI01000020_04807118_04808453 NA other upstream 844863 4806765 ~ 4809414 (+)
CI01000020_04760482_04774849 NA other upstream 875388 4760012 ~ 4776083 (+)
G113050 NA other upstream 1228887 4426658 ~ 4439762 (+)
G114094 NA other downstream 134195 5803052 ~ 5805718 (+)
G114382 NA other downstream 923367 6592224 ~ 6593564 (+)
G114389 NA other downstream 929489 6598346 ~ 6600180 (+)
G114388 NA other downstream 955410 6617328 ~ 6644816 (+)

Expression


Co-expression Network