G114238



Basic Information


Item Value
gene id G114238
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 6164667 ~ 6166211 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU129744
AGGGAAACCAGTCGTGGGGATGGGGAGGTACAAAGATCTCCAAGAGCAAATATCCCAGAAACTATGTGATTTTTTACAAGACTTGGAAGATTACTGCGGGTCATCCAGAAGTCTTTGTCATCTTTATTCAGTTTCCCTATGGCTTGAGCCAATGGCACGAAGAGAGTGAAATTTTCTGCCTTCGACAGTAGTTGAGAAAGATCCGCTCGAGCAATCCAGAGGTTAAATTCTTGAAGATCTGGGTTTGTTGACACCTCCTGTGCTAGTGTGCCATAACAAATTTCCCCGTCACCATCGTAGCCGTCCTCACACACACACTGCCATCCACCTGGGCTCAGAAACTTGCAGGTGCCCAGGAAATGGCATCCACCCTTCTGTTCCACACACTGATTGACAGGTTCACATTGCTTCCCGTTTCCATGGTAACCACTTTTGCAAGCACAATCGCTCTAGGGAGAATATCAATCATCAAAAATAATATGAATTCAGGTAGATGGGGTTTGAGAATCACAACGACCACTCTCACCTGTCCTGGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU129744 True 536 lncRNA 0.46 5 6164667 6166211

Neighbor


gene id symbol gene type direction distance location
CI01000020_06122192_06132967 PPFIBP1A coding upstream 31024 6122192 ~ 6133643 (+)
CI01000020_06035989_06042016 TMTC2A coding upstream 122647 6035989 ~ 6042020 (+)
CI01000020_06000788_06005009 NA coding upstream 159531 6000727 ~ 6005136 (+)
CI01000020_05988468_05989551 NA coding upstream 175114 5988251 ~ 5989553 (+)
CI01000020_05960777_05981596 NA coding upstream 182369 5960777 ~ 5982298 (+)
CI01000020_06272024_06286697 NA coding downstream 105813 6272024 ~ 6286956 (+)
CI01000020_06652576_06656275 NA coding downstream 486365 6652576 ~ 6656971 (+)
CI01000020_06769551_06772924 NA coding downstream 603099 6769310 ~ 6774074 (+)
CI01000020_06784747_06793255 NA coding downstream 618260 6784471 ~ 6794581 (+)
CI01000020_06795794_06800988 GLT8D2 coding downstream 629583 6795794 ~ 6801095 (+)
G114230 NA non-coding upstream 22107 6138651 ~ 6142560 (+)
G114161 NA non-coding upstream 29388 6134530 ~ 6135279 (+)
G114217 NA non-coding upstream 66951 6097491 ~ 6097716 (+)
G114216 NA non-coding upstream 67788 6096644 ~ 6096879 (+)
G114200 NA non-coding upstream 94351 6070104 ~ 6070316 (+)
G114242 NA non-coding downstream 5048 6171259 ~ 6181364 (+)
G114256 NA non-coding downstream 43393 6209604 ~ 6211436 (+)
G114274 NA non-coding downstream 60663 6226874 ~ 6230133 (+)
G114284 NA non-coding downstream 84856 6251067 ~ 6251391 (+)
G114355 NA non-coding downstream 248797 6415008 ~ 6416595 (+)
G114094 NA other upstream 358949 5803052 ~ 5805718 (+)
G113929 NA other upstream 539435 5622707 ~ 5625232 (+)
CI01000020_05267250_05267668 MRPS33 other upstream 895994 5267250 ~ 5268673 (+)
CI01000020_04807118_04808453 NA other upstream 1340881 4806765 ~ 4809414 (+)
G114382 NA other downstream 426013 6592224 ~ 6593564 (+)
G114389 NA other downstream 432135 6598346 ~ 6600180 (+)
G114388 NA other downstream 458056 6617328 ~ 6644816 (+)
G114413 NA other downstream 637337 6803548 ~ 6808718 (+)

Expression



Co-expression Network