G114499


Basic Information

Item Value
gene id G114499
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 6778779 ~ 6778981 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU130049
ATCGCTGTGACCGCTCCATCTTTCAGTTTCAAACGAACTGTAAATCCAGCGTCGAACTGGGCCTTGTTTATAAAACCATAAGCACCGATCCCGAGGGCTCGAGCAGCCATGGAAAAACACGAGATATTCACCATTCATTTTAACCAGTAAAAAAGTGATTTCAACTATCAGTTTCTATGATTATTTTAATAAAAAATATCGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU130049 True 203 lncRNA 0.39 1 6778779 6778981

Neighbor

gene id symbol gene type direction distance location
CI01000020_06769551_06772924 NA coding upstream 5616 6769310 ~ 6774074 (+)
CI01000020_06652576_06656275 NA coding upstream 121808 6652576 ~ 6656971 (+)
CI01000020_06272024_06286697 NA coding upstream 491823 6272024 ~ 6286956 (+)
CI01000020_06122192_06132967 PPFIBP1A coding upstream 645136 6122192 ~ 6133643 (+)
CI01000020_06035989_06042016 TMTC2A coding upstream 736759 6035989 ~ 6042020 (+)
CI01000020_06784747_06793255 NA coding downstream 5490 6784471 ~ 6794581 (+)
CI01000020_06795794_06800988 GLT8D2 coding downstream 16813 6795794 ~ 6801095 (+)
CI01000020_06809322_06816591 NA coding downstream 30341 6809322 ~ 6816591 (+)
CI01000020_06819838_06824266 PARP12B coding downstream 40857 6819838 ~ 6824669 (+)
CI01000020_06833378_06846518 NA coding downstream 54361 6833342 ~ 6846776 (+)
G114494 NA non-coding upstream 18945 6759601 ~ 6759834 (+)
G114491 NA non-coding upstream 22646 6755872 ~ 6756133 (+)
G114478 NA non-coding upstream 97758 6680473 ~ 6681021 (+)
G114440 NA non-coding upstream 129215 6648227 ~ 6649564 (+)
G114464 NA non-coding upstream 131203 6647124 ~ 6647576 (+)
G114500 NA non-coding downstream 18 6778999 ~ 6779514 (+)
G114501 NA non-coding downstream 737 6779718 ~ 6779923 (+)
G114505 NA non-coding downstream 31666 6810647 ~ 6810919 (+)
G114436 NA non-coding downstream 134473 6913454 ~ 6914288 (+)
G114427 NA non-coding downstream 159932 6938913 ~ 6940153 (+)
G114388 NA other upstream 133963 6617328 ~ 6644816 (+)
G114389 NA other upstream 178599 6598346 ~ 6600180 (+)
G114382 NA other upstream 185215 6592224 ~ 6593564 (+)
CI01000020_05960777_05981596 NA other upstream 797531 5960777 ~ 5982298 (+)
G114413 NA other downstream 24567 6803548 ~ 6808718 (+)

Expression


Co-expression Network