G114427


Basic Information

Item Value
gene id G114427
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 6938913 ~ 6940153 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU129976
GTCGCTACAACACGTGCAGATGACAGCTATCACACAACTGCACATATTCCAGCAAATAAACCGACACACAGTGCGATAAAATGCGGGAATTGAGTGTCATTTAACTCCCCGAATAAGGGATGTTTGGACACCCAGTCATCAGAAGCAGAGCTGTAGGAAGTGTGGACAGACATTGACTGTAATGATGGACTTCTGCTGATGGACAGAAGCATAACCCTTCCTGGACATCGTGCCATGACTCAGGGGGGGACCCGAATCATCCCCGCCCCTTCACGCACACACCATTCACTCATATCGCGGAGATCTGACTGGGATCAAACCAGCAACCTCTGAACCCGTGAGGCAGCGCTCTTAACCTGTGAGCCACAGATCTCTTGTCTGAACATGTGCAGGAACTTATATTTCACTATTCACCTGTATGATTTTACAATAAACCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU129976 True 438 lncRNA 0.48 3 6938913 6940153

Neighbor

gene id symbol gene type direction distance location
CI01000020_06927376_06933108 DMTF1 coding upstream 5497 6926690 ~ 6933416 (+)
CI01000020_06906111_06910886 TSPAN9A, TSPAN9B, TSPAN9, TSN9 coding upstream 27934 6906111 ~ 6910979 (+)
CI01000020_06860988_06887829 MICAL3B coding upstream 50879 6860988 ~ 6888034 (+)
CI01000020_06852155_06857778 SVOPL coding upstream 81128 6852155 ~ 6857785 (+)
CI01000020_06833378_06846518 NA coding upstream 92137 6833342 ~ 6846776 (+)
CI01000020_06944393_06947480 ARL1 coding downstream 4171 6944324 ~ 6947480 (+)
CI01000020_06992285_07002537 NA coding downstream 52132 6992285 ~ 7002547 (+)
CI01000020_07014667_07020555 FOXM1 coding downstream 74514 7014667 ~ 7020990 (+)
CI01000020_07029337_07034375 PGM3 coding downstream 89184 7029337 ~ 7034438 (+)
CI01000020_07043558_07046909 CCNC coding downstream 103405 7043558 ~ 7046909 (+)
G114436 NA non-coding upstream 24625 6913454 ~ 6914288 (+)
G114505 NA non-coding upstream 127994 6810647 ~ 6810919 (+)
G114501 NA non-coding upstream 158990 6779718 ~ 6779923 (+)
G114500 NA non-coding upstream 159399 6778999 ~ 6779514 (+)
G114499 NA non-coding upstream 159932 6778779 ~ 6778981 (+)
G114532 NA non-coding downstream 137026 7077179 ~ 7079432 (+)
G114540 NA non-coding downstream 139435 7079588 ~ 7080932 (+)
CI01000020_07089227_07093896 NA non-coding downstream 141261 7081414 ~ 7093978 (+)
G114541 NA non-coding downstream 150054 7090207 ~ 7090476 (+)
CI01000020_07097679_07107859 NA non-coding downstream 163035 7097679 ~ 7109571 (+)
G114413 NA other upstream 130195 6803548 ~ 6808718 (+)
CI01000020_06769551_06772924 NA other upstream 164839 6769310 ~ 6774074 (+)
G114388 NA other upstream 294097 6617328 ~ 6644816 (+)
G114389 NA other upstream 338733 6598346 ~ 6600180 (+)
G114382 NA other upstream 345349 6592224 ~ 6593564 (+)

Expression


Co-expression Network