G114541


Basic Information

Item Value
gene id G114541
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000020
NCBI id null
chromosome length 7209782
location 7090207 ~ 7090476 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU130101
CGTTGGAAAGGTCACACGTGATGTAGGCGGAAGTACCGCGGTAGGGCGAAAAACTCCATCTCATTTTCTCCTCCAACTTCAAAATCGTCCGACATCATTGTTTTACCTTTTTTTGTAAAGCGTTTGGCTTAGTCTTTGCACGTTCGCTTTGTGGACACTGGATTGGTACTTCCGTCTGCGCATCACAGAGCAGTGCAAGACAAGCATTTGTGGTTAAAAAGTGTATAAATGACAGATCGTTTCGCTAGACATGACACTTATTTCTCGTCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU130101 True 270 lncRNA 0.44 1 7090207 7090476

Neighbor

gene id symbol gene type direction distance location
CI01000020_07050004_07055580 FAXCA coding upstream 34379 7049394 ~ 7055828 (+)
CI01000020_07043558_07046909 CCNC coding upstream 43298 7043558 ~ 7046909 (+)
CI01000020_07029337_07034375 PGM3 coding upstream 55769 7029337 ~ 7034438 (+)
CI01000020_07014667_07020555 FOXM1 coding upstream 69217 7014667 ~ 7020990 (+)
CI01000020_06992285_07002537 NA coding upstream 87660 6992285 ~ 7002547 (+)
CI01000020_07097679_07107859 NA coding downstream 7203 7097679 ~ 7109571 (+)
CI01000020_07116109_07120411 RSPH9 coding downstream 25564 7116040 ~ 7120580 (+)
CI01000020_07160189_07169882 VEGFAB coding downstream 69629 7160105 ~ 7170046 (+)
CI01000020_07089227_07093896 NA non-coding upstream 453 7081414 ~ 7093978 (+)
G114540 NA non-coding upstream 9275 7079588 ~ 7080932 (+)
G114532 NA non-coding upstream 10775 7077179 ~ 7079432 (+)
G114427 NA non-coding upstream 150054 6938913 ~ 6940153 (+)
G114436 NA non-coding upstream 175919 6913454 ~ 6914288 (+)
G114529 NA non-coding downstream 84253 7174729 ~ 7175341 (+)
G114413 NA other upstream 281489 6803548 ~ 6808718 (+)
CI01000020_06769551_06772924 NA other upstream 316133 6769310 ~ 6774074 (+)
G114388 NA other upstream 445391 6617328 ~ 6644816 (+)
G114389 NA other upstream 490027 6598346 ~ 6600180 (+)
G114382 NA other upstream 496643 6592224 ~ 6593564 (+)

Expression


Co-expression Network