G115754


Basic Information

Item Value
gene id G115754
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000021
NCBI id null
chromosome length 7014339
location 1184669 ~ 1184936 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU131482
AAGCATTGTGTGTTCTCTGACATCATTAAAACAAGCAGTATAGTGTTTCAACCTGGCGAGCTGTATCAGTAGAGTGACCTGCTATAAGATGGTTTTGCTTCGGGGGTAGAGAAGGTCGTTTTGTGCAAGAACGGAACGAGTAAATGAGATATAAGGCAGGAAGAGAGACAGCTACAAGAGTCAAGGAATAGCGGTCTGGTTAGCAAAAACATTGACACTGAATGAGAGAAAAGGAAAGAAAAGATAGGAGCTTGTTAAGGCTAAACAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU131482 True 268 lncRNA 0.42 1 1184669 1184936

Neighbor

gene id symbol gene type direction distance location
CI01000021_01129847_01154032 UCKL1B, UCKL1 coding upstream 30361 1129847 ~ 1154308 (+)
CI01000021_01100408_01104630 NA coding upstream 80039 1100408 ~ 1104630 (+)
CI01000021_00972210_01064592 SAMD10 coding upstream 119954 971213 ~ 1064715 (+)
CI01000021_00822848_00831637 NA coding upstream 352989 822848 ~ 831680 (+)
CI01000021_00748689_00750893 AQP6, MIPB, MIPA, MIP coding upstream 433669 748141 ~ 751000 (+)
CI01000021_01219723_01256723 ZBTB46 coding downstream 34787 1219723 ~ 1257080 (+)
CI01000021_01264188_01268643 NA coding downstream 77502 1262438 ~ 1268865 (+)
CI01000021_01274202_01280110 NA coding downstream 88658 1273594 ~ 1281759 (+)
CI01000021_01288735_01291953 LMOD3 coding downstream 103660 1288596 ~ 1291962 (+)
CI01000021_01332646_01333910 NA coding downstream 146729 1331665 ~ 1333951 (+)
G115750 NA non-coding upstream 2721 1181724 ~ 1181948 (+)
G115685 NA non-coding upstream 69333 1110455 ~ 1115336 (+)
G115721 NA non-coding upstream 290710 893528 ~ 893959 (+)
G115681 NA non-coding upstream 301544 867315 ~ 883125 (+)
G115716 NA non-coding upstream 307286 876775 ~ 877383 (+)
G115759 NA non-coding downstream 4546 1189482 ~ 1189711 (+)
G115684 NA non-coding downstream 126891 1311827 ~ 1316148 (+)
G115791 NA non-coding downstream 200003 1384939 ~ 1386229 (+)
G115780 NA non-coding downstream 223267 1408203 ~ 1408451 (+)
G115817 NA non-coding downstream 225391 1410327 ~ 1410607 (+)
G115519 NA other upstream 700705 480530 ~ 483964 (+)
G116236 NA other downstream 1104881 2289817 ~ 2297195 (+)
G117237 NA other downstream 2052918 3237854 ~ 3243364 (+)
G117202 NA other downstream 2084208 3269144 ~ 3328233 (+)
G117484 NA other downstream 2771210 3956146 ~ 3957752 (+)

Expression


Co-expression Network