G115780


Basic Information

Item Value
gene id G115780
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000021
NCBI id null
chromosome length 7014339
location 1408203 ~ 1408451 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU131513
CTTCCTGCCATCCACAGCGCATGCCGAAGTTGCCTCCGCCCGTAACTCCTCCTCCTCCTCCTCCAGACCGGGTGGCCTGAGAGTGGGGCGGCTGGGGAGGAGGCTCCATGGCTTCCACGTCCCGCAGGCAGCTCATGTAGCGTGGGTTGCAGAGAGAGGAGCCAACCTTGCGCTTGGACTTCTTGCCATTGCGCTCGCCCCACACGGTCTTACGATCATCCACTCTGGCCACTAGGAAGCCGTTGATCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU131513 True 249 lncRNA 0.63 1 1408203 1408451

Neighbor

gene id symbol gene type direction distance location
CI01000021_01332646_01333910 NA coding upstream 74252 1331665 ~ 1333951 (+)
CI01000021_01288735_01291953 LMOD3 coding upstream 116241 1288596 ~ 1291962 (+)
CI01000021_01274202_01280110 NA coding upstream 126444 1273594 ~ 1281759 (+)
CI01000021_01264188_01268643 NA coding upstream 139338 1262438 ~ 1268865 (+)
CI01000021_01219723_01256723 ZBTB46 coding upstream 151123 1219723 ~ 1257080 (+)
CI01000021_01463736_01472529 CACNB3, CACNB3A, CACNB3B coding downstream 55285 1463736 ~ 1472886 (+)
CI01000021_01506852_01513139 BIRC7 coding downstream 97765 1506216 ~ 1513306 (+)
CI01000021_01519982_01528860 GSS coding downstream 111531 1519982 ~ 1529105 (+)
CI01000021_01717640_01718394 NA coding downstream 309189 1717640 ~ 1718879 (+)
CI01000021_01771612_01785627 EXOSC10 coding downstream 362938 1771389 ~ 1785666 (+)
G115791 NA non-coding upstream 21974 1384939 ~ 1386229 (+)
G115684 NA non-coding upstream 92055 1311827 ~ 1316148 (+)
G115759 NA non-coding upstream 218492 1189482 ~ 1189711 (+)
G115754 NA non-coding upstream 223267 1184669 ~ 1184936 (+)
G115750 NA non-coding upstream 226255 1181724 ~ 1181948 (+)
G115817 NA non-coding downstream 1876 1410327 ~ 1410607 (+)
G115824 NA non-coding downstream 18024 1426475 ~ 1426764 (+)
G115856 NA non-coding downstream 34804 1443255 ~ 1450354 (+)
G115836 NA non-coding downstream 87985 1496436 ~ 1506142 (+)
G115870 NA non-coding downstream 108230 1516681 ~ 1516942 (+)
G115519 NA other upstream 924239 480530 ~ 483964 (+)
G116236 NA other downstream 881366 2289817 ~ 2297195 (+)
G117237 NA other downstream 1829403 3237854 ~ 3243364 (+)
G117202 NA other downstream 1860693 3269144 ~ 3328233 (+)
G117484 NA other downstream 2547695 3956146 ~ 3957752 (+)
G117493 NA other downstream 2624549 4033000 ~ 4035676 (+)

Expression


Co-expression Network