G116872


Basic Information

Item Value
gene id G116872
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000021
NCBI id null
chromosome length 7014339
location 2250802 ~ 2251285 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU132774
CCAGTCACTTACCAGGGGGACAAAAGTCAACCCCAAGGGCCACCAGGGAGGCCGAACCAGCCCAGCCAAGGGCTAGTCAGGCCAACAACCTGTCTGAAAGAACAGAATCTCTGCAAACTTCCTCAGAGAGGAAAATCCTGTGAGAGGGACTGCAAAGAGGCAGTACCGAACTCACCGGACCAGAGATGGGCACCCCTGGGAGTAGAGCTCAGCAAATTGCTTTAGACCCTGAAAGAGGGGAGCAACCTACTCAACCTAGGAACTACAGAGTGAGACTGAAGCACTCTGGAGACTGAGTACTCAACCTAAGCCAGGAGAGGAACAGAGACTGAAATATAGTAGGAGACAGAAAACACTCCTAACATATAGACCGAACTCACCGAGTATAGACCGAGTATCAACAGCCTAATACCGATCCTTCAGGGCGGTCTCTAAAGAGTCCTTCTACCTTCTGACCAGTCTTTGGGAGCAAGTCCTAACAACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU132774 True 484 lncRNA 0.51 1 2250802 2251285

Neighbor

gene id symbol gene type direction distance location
CI01000021_02191178_02193192 NA coding downstream 57454 2190044 ~ 2193348 (-)
CI01000021_02104468_02137901 NA coding downstream 110893 2104098 ~ 2139909 (-)
CI01000021_02045322_02085906 NA coding downstream 164565 2044938 ~ 2086237 (-)
CI01000021_02005120_02042997 SULF2B, SULF2 coding downstream 207635 2004826 ~ 2043167 (-)
CI01000021_01922936_01956597 NA coding downstream 294205 1922719 ~ 1956597 (-)
CI01000021_02290326_02297117 EEF1A1, EEF1A2, EEF1A1A, EEF1A2.S coding upstream 38658 2289943 ~ 2297117 (-)
CI01000021_02299075_02305974 MRGBP coding upstream 47139 2298424 ~ 2305974 (-)
CI01000021_02309119_02315738 NA coding upstream 57739 2309024 ~ 2315738 (-)
CI01000021_02317457_02320931 HAUS8 coding upstream 66172 2317457 ~ 2321663 (-)
CI01000021_02335864_02337990 NA coding upstream 84078 2335363 ~ 2341260 (-)
G116848 NA non-coding downstream 62310 2187864 ~ 2188492 (-)
G116847 NA non-coding downstream 62984 2187578 ~ 2187818 (-)
G116805 NA non-coding downstream 439463 1810846 ~ 1811339 (-)
G116834 NA non-coding downstream 463120 1787299 ~ 1787682 (-)
G116833 NA non-coding downstream 463829 1786218 ~ 1786973 (-)
G116889 NA non-coding upstream 76778 2328063 ~ 2329874 (-)
G116891 NA non-coding upstream 78941 2330226 ~ 2330431 (-)
G116900 NA non-coding upstream 79398 2330683 ~ 2331076 (-)
G116957 NA non-coding upstream 283783 2535068 ~ 2535384 (-)
G116856 NA other downstream 40306 2209921 ~ 2210496 (-)
G116730 NA other downstream 887998 1361878 ~ 1362804 (-)
G116893 NA other upstream 80029 2331314 ~ 2334316 (-)
G116997 NA other upstream 461500 2712785 ~ 2713247 (-)
G117683 NA other upstream 640575 2891860 ~ 2892359 (-)
G117893 NA other upstream 792734 3044019 ~ 3044787 (-)
CI01000021_03902018_03931315 ACSS2 other upstream 1586137 3901897 ~ 3932508 (-)

Expression


Co-expression Network