G117836


Basic Information

Item Value
gene id G117836
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000021
NCBI id null
chromosome length 7014339
location 4207762 ~ 4208067 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU133905
TGCCTGCTGCCTGTCACTCTTGCTGTTCCCCTTCCTTCATCATCTTCCTCCTTTAAAGGGATAGTTCACTCAAAAGTGAAAAGTCTTTCCAAACTCATAGAACTTTATCGCTTCTGTGGAACACAAAAGAATACATTTTGAAAAATTTACTAGTCACTCTTTTCCATGAAATTACAATAATTGTGTGCGCTGTGTGAACATGATGGTTATTGTAGAGCATTTACACATCTCACTGGCACAAAAAAAGATTCAGTATACCTCAAAATGAATAGAAAATTGAAATGCAAACTCAGAATATTACACAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU133905 True 306 lncRNA 0.35 1 4207762 4208067

Neighbor

gene id symbol gene type direction distance location
CI01000021_04191779_04194388 NA coding downstream 13363 4191606 ~ 4194399 (-)
CI01000021_04183864_04186516 SOX18 coding downstream 21206 4183179 ~ 4186556 (-)
CI01000021_04102462_04141661 NA coding downstream 65737 4100664 ~ 4142025 (-)
CI01000021_04061478_04074988 XKR7 coding downstream 132774 4061478 ~ 4074988 (-)
CI01000021_04035411_04049515 CCM2L coding downstream 158247 4035189 ~ 4049592 (-)
CI01000021_04248892_04258642 RGS19 coding upstream 39997 4248064 ~ 4258784 (-)
CI01000021_04529150_04530169 NPBWR2 coding upstream 320357 4528424 ~ 4530359 (-)
CI01000021_04554591_04555147 NA coding upstream 346420 4554487 ~ 4555870 (-)
CI01000021_04567226_04567519 NA coding upstream 359080 4567147 ~ 4567616 (-)
CI01000021_04803637_04803849 NA coding upstream 595096 4803163 ~ 4803849 (-)
G118223 NA non-coding downstream 3654 4203692 ~ 4204108 (-)
G117841 NA non-coding downstream 25284 4181899 ~ 4182478 (-)
G118205 NA non-coding downstream 53708 4153833 ~ 4154054 (-)
G118202 NA non-coding downstream 57978 4149552 ~ 4149784 (-)
G118158 NA non-coding downstream 381793 3824509 ~ 3825969 (-)
G117804 NA non-coding upstream 27917 4235984 ~ 4236414 (-)
G117757 NA non-coding upstream 34549 4242616 ~ 4244069 (-)
G117775 NA non-coding upstream 57882 4265949 ~ 4271794 (-)
G117844 NA non-coding upstream 83126 4291193 ~ 4292476 (-)
G118297 NA non-coding upstream 298227 4506294 ~ 4506616 (-)
CI01000021_03902018_03931315 ACSS2 other downstream 276044 3901897 ~ 3932508 (-)
G117893 NA other downstream 1162975 3044019 ~ 3044787 (-)
G117683 NA other downstream 1315427 2891860 ~ 2892359 (-)
G116997 NA other downstream 1494515 2712785 ~ 2713247 (-)
G118639 NA other upstream 542030 4750097 ~ 4767372 (-)
G118801 NA other upstream 945824 5153891 ~ 5154291 (-)
G119215 NA other upstream 1316788 5524855 ~ 5530926 (-)
G119267 NA other upstream 1405375 5613442 ~ 5613989 (-)
G119233 NA other upstream 1573007 5781074 ~ 5782246 (-)

Expression


Co-expression Network