G117641



Basic Information


Item Value
gene id G117641
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000021
NCBI id null
chromosome length 7014339
location 4401285 ~ 4401498 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU133681
TTTCTATGAGAGCAAAGGGAGGCATGTCTCCTGTGTAACTTTACCTGCGGGTGTCGCTGTTGGGCAGTGATCCTTAAGACATACGAGTGACTTGCGCTCTTTTTAATGTCATAATTTGTAATATTTGTGTTGTTTTATATGTAATATGGATTATTTTCTCATCCTATTTTTTTTGAGGAGGCACTGCCTCCCTTGCCTCCTCGGAGGAAATGCC

Function


NR:

description
PREDICTED: bromodomain adjacent to zinc finger domain protein 1A

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU133681 True 214 lncRNA 0.42 1 4401285 4401498

Neighbor


gene id symbol gene type direction distance location
CI01000021_04259458_04263656 NA coding upstream 137179 4259157 ~ 4264106 (+)
CI01000021_04219242_04237829 NA coding upstream 163278 4219187 ~ 4238007 (+)
CI01000021_04087145_04091630 NA coding upstream 309459 4085974 ~ 4091826 (+)
CI01000021_03793387_03846383 NA coding upstream 554902 3793387 ~ 3846383 (+)
CI01000021_03640760_03747887 LAMA5 coding upstream 653398 3640760 ~ 3747887 (+)
CI01000021_04436103_04476829 OPRL1 coding downstream 34329 4435827 ~ 4477311 (+)
CI01000021_04576127_04585164 NA coding downstream 174629 4576127 ~ 4585311 (+)
CI01000021_04614553_04621970 NA coding downstream 212267 4613765 ~ 4622428 (+)
CI01000021_04755472_04758504 NA coding downstream 353974 4755472 ~ 4758654 (+)
CI01000021_04763908_04787185 MYT1B, MYT1 coding downstream 362410 4763908 ~ 4787967 (+)
G117638 NA non-coding upstream 7506 4393448 ~ 4393779 (+)
G117608 NA non-coding upstream 103956 4296745 ~ 4297329 (+)
G117435 NA non-coding upstream 157207 4242624 ~ 4244078 (+)
G117587 NA non-coding upstream 161446 4239627 ~ 4239839 (+)
G117583 NA non-coding upstream 191692 4209172 ~ 4209593 (+)
G117644 NA non-coding downstream 5466 4406964 ~ 4470905 (+)
G118374 NA non-coding downstream 197050 4598548 ~ 4598759 (+)
G118405 NA non-coding downstream 232004 4633502 ~ 4633936 (+)
G118409 NA non-coding downstream 238429 4639927 ~ 4640220 (+)
G118416 NA non-coding downstream 259840 4661338 ~ 4661573 (+)
G117493 NA other upstream 365609 4033000 ~ 4035676 (+)
G117484 NA other upstream 443533 3956146 ~ 3957752 (+)
G117202 NA other upstream 1073052 3269144 ~ 3328233 (+)
G117237 NA other upstream 1157921 3237854 ~ 3243364 (+)
G116236 NA other upstream 2104090 2289817 ~ 2297195 (+)
CI01000021_04886787_04893309 PLAGL2 other downstream 441235 4886337 ~ 4893474 (+)
G119701 NA other downstream 2398646 6800144 ~ 6860606 (+)

Expression



Co-expression Network