XLOC_008332


Basic Information

Item Value
gene id XLOC_008332
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 9680021 ~ 9684915 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00018760
ctcagtgcaaggtaaaatcagtatgttctgcatttaagtcgtttaattaagaaatacctattcttacaaagtaacatcacatgtattcatatttattgtaaaaactttttagtgtgcaaatgtttgtgtactggaataaatttgcaattgaaacaacaagatgaccgacaccctccattacaaacattacctgcggtattctatgtggtaaaccatcaaatgttatgtggtaactgtgtagtactttgttgttttttgggatgttttctgtgttgtacagtatgtaatactcctgcggtattcttgtggtagtgtgtggtatcacttaaacatttctgtggcaccacaggattctgttgcttagtatgtaatactcctg

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0065007 biological regulation biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044238 primary metabolic process biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0050789 regulation of biological process biological_process
GO:0050794 regulation of cellular process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0043169 cation binding molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko03070 Bacterial secretion system
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00018760 True 379 lncRNA 0.35 2 9680021 9684915

Neighbor

gene id symbol gene type direction distance location
XLOC_008331 NA coding upstream 30565 9640687 ~ 9649456 (+)
XLOC_008330 CR936974.1 coding upstream 222639 9451978 ~ 9457382 (+)
XLOC_008329 FP016239.1 coding upstream 261870 9414153 ~ 9418151 (+)
XLOC_008328 FP016239.2 coding upstream 292231 9387350 ~ 9387790 (+)
XLOC_008327 sgcg coding upstream 326325 9327252 ~ 9353696 (+)
XLOC_008333 si:dkey-13m3.2 coding downstream 177058 9861973 ~ 9873144 (+)
XLOC_008334 BX000985.1 coding downstream 193933 9878848 ~ 9883813 (+)
XLOC_008335 BX000985.2 coding downstream 210943 9895858 ~ 9895986 (+)
XLOC_008336 CU856523.1 coding downstream 800619 10485534 ~ 10487195 (+)
XLOC_008337 CT573316.1 coding downstream 1065293 10750208 ~ 10756943 (+)
XLOC_008463 BX663520.1 misc downstream 11567276 21252191 ~ 21252282 (+)
XLOC_008325 CU467862.1 non-coding upstream 468890 9205264 ~ 9211131 (+)
XLOC_008321 CR925772.1 non-coding upstream 640857 9039050 ~ 9039164 (+)
XLOC_008338 NA non-coding downstream 1067156 10752071 ~ 10754765 (+)

Expression


Co-expression Network