CI01000026_14680424_14682203 (TK2)


Basic Information

Item Value
gene id CI01000026_14680424_14682203
gene name TK2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 14680359 ~ 14682203 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000026_14680424_14682203.mRNA
TCACTGCCAATCAGAATGCTGGAAAGATCTATTTACAGCGCTAAATACATTTTTGTGGAAAATCTTTTTAAAAGTGGGAAGATGCCTGATGTGGACTTTGCTGTTTTAAGCGAATGGTTTGAGTGGATCATAAAGAACATTGCTATTCCTGTGGACCTTATTGTTTACCTGCAGACCTCTCCACAGACCTGCTACGAGAGACTAAAGCAGAGGTGCAGAGAGGAAGAAAAGGTTATTCCCTTGGTAATCCCAGCAGATCATGATCTTAAGAAGATGCTGCATAAATATGAGGAGAACAGAGAGAAGATACTAAAGTTCTGTTCATTCTGCCATTTGCAGATACCATCACTGACAAATACAGATCCTGACTGTTAATTTGTTACTGAAGGTGGTACTGTGACCAATGTAATTTATACTGCATAAGACATTGTTTTAATAAA

Function

symbol description
tk2 Predicted to enable deoxynucleoside kinase activity. Predicted to act upstream of or within nucleobase-containing compound metabolic process and phosphorylation. Predicted to be active in cytoplasm. Is expressed in exocrine pancreas and pectoral fin. Human ortholog(s) of this gene implicated in autosomal recessive progressive external ophthalmoplegia with mitochondrial DNA deletions 3 and mitochondrial DNA depletion syndrome 2. Orthologous to human TK2 (thymidine kinase 2).

GO: NA

KEGG:

id description
K00857 tdk, TK; thymidine kinase

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000026_14680424_14682203.mRNA True 440 mRNA 0.38 5 14680359 14682203

Neighbor

gene id symbol gene type direction distance location
CI01000026_14376741_14381102 NA coding downstream 298266 14376570 ~ 14382093 (-)
CI01000026_14156809_14170720 CDH11 coding downstream 509639 14156349 ~ 14170720 (-)
CI01000026_13744060_13791879 CDH8 coding downstream 888480 13744060 ~ 13791879 (-)
CI01000026_13299234_13300178 NA coding downstream 1379419 13298482 ~ 13300940 (-)
CI01000026_13082079_13210565 ITFG1 coding downstream 1469794 13082079 ~ 13210565 (-)
CI01000026_14684215_14684738 NA coding upstream 2000 14684203 ~ 14685091 (-)
CI01000026_14697383_14715245 CMTM4 coding upstream 14840 14697043 ~ 14715245 (-)
CI01000026_14720591_14737569 DYNC1LI2 coding upstream 37613 14719816 ~ 14737569 (-)
CI01000026_14780225_14789500 NAE1 coding upstream 97885 14780088 ~ 14790709 (-)
CI01000026_14823390_14854983 CDH16 coding upstream 140804 14823007 ~ 14854983 (-)
G136170 NA non-coding downstream 13782 14666345 ~ 14666577 (-)
G136156 NA non-coding downstream 42379 14637520 ~ 14637980 (-)
G136103 NA non-coding downstream 44356 14589930 ~ 14636003 (-)
G136129 NA non-coding downstream 72780 14606651 ~ 14607579 (-)
G136107 NA non-coding downstream 101041 14576171 ~ 14579318 (-)
G136214 NA non-coding upstream 169564 14851767 ~ 14852100 (-)
G136344 NA non-coding upstream 377747 15059950 ~ 15060174 (-)
G136377 NA non-coding upstream 394608 15076811 ~ 15077839 (-)
G136609 NA non-coding upstream 661007 15343210 ~ 15343413 (-)
G136845 NA non-coding upstream 725309 15407512 ~ 15407792 (-)
G136110 NA other downstream 124923 14554917 ~ 14555436 (-)
G133802 NA other downstream 3373178 11301915 ~ 11307181 (-)
G133790 NA other downstream 3842754 10834015 ~ 10859589 (-)
CI01000026_10788054_10788652 CD59 other downstream 3890205 10787339 ~ 10789709 (-)
CI01000026_10347872_10351783 CEBPA other downstream 4331402 10347746 ~ 10351783 (-)
CI01000026_16756776_16760261 RBPMS2A, RBPMS2B, RBPMS2 other upstream 2074526 16756729 ~ 16761341 (-)
G137667 NA other upstream 2124161 16806364 ~ 16808372 (-)
G137914 NA other upstream 2301048 16983251 ~ 16984352 (-)
G137967 NA other upstream 2386145 17068348 ~ 17069433 (-)

Expression


Co-expression Network