G132645


Basic Information

Item Value
gene id G132645
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 9525972 ~ 9526188 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU150856
TGCCTTGATTTTGCCGGGTGGACTAAAAGCAGACTGCACATAGCCTATCCAATTCAGAGCTAAATCGTGACTACAGATAGACCATGTCATGAAATGACACTTAAATCTTGTAGATATCATTGACATTGCGAACATGATGGGATATCAACCATCTCATGCACTTCCTGTCTAAAAACTACAATAAATCAGGATTGACTAAAGGTGGGCTACAAATAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU150856 True 217 lncRNA 0.40 1 9525972 9526188

Neighbor

gene id symbol gene type direction distance location
CI01000026_09365911_09428712 CHD9 coding upstream 96896 9364907 ~ 9429076 (+)
CI01000026_09339450_09352303 AKTIP coding upstream 172795 9339450 ~ 9353177 (+)
CI01000026_09175446_09178464 NA coding upstream 347484 9175249 ~ 9178488 (+)
CI01000026_09076625_09079154 IRX3A, IRX3 coding upstream 446634 9075216 ~ 9079338 (+)
CI01000026_08950735_08960908 NA coding upstream 564826 8950663 ~ 8961146 (+)
CI01000026_09602263_09635635 TOX3 coding downstream 75455 9601643 ~ 9636994 (+)
CI01000026_09666763_09669325 NA coding downstream 140492 9666680 ~ 9669702 (+)
CI01000026_09900193_09906874 SALL1A, SALL1 coding downstream 374005 9900193 ~ 9907237 (+)
CI01000026_09915483_09917692 NA coding downstream 389257 9915445 ~ 9917919 (+)
CI01000026_10124232_10124468 NA coding downstream 597728 10123916 ~ 10125835 (+)
G132637 NA non-coding upstream 7064 9518596 ~ 9518908 (+)
G132429 NA non-coding upstream 79940 9445830 ~ 9446032 (+)
G132421 NA non-coding upstream 91652 9434091 ~ 9434320 (+)
G132412 NA non-coding upstream 226814 9298674 ~ 9299158 (+)
G132377 NA non-coding upstream 297807 9223849 ~ 9228165 (+)
G132655 NA non-coding downstream 23277 9549465 ~ 9549745 (+)
G132657 NA non-coding downstream 23964 9550152 ~ 9550660 (+)
G132656 NA non-coding downstream 24676 9550864 ~ 9551463 (+)
G132658 NA non-coding downstream 25527 9551715 ~ 9552074 (+)
G132659 NA non-coding downstream 26166 9552354 ~ 9552554 (+)
G131077 NA other upstream 1019185 8501408 ~ 8506787 (+)
CI01000026_08297901_08307596 CTRB1 other upstream 1226558 8297857 ~ 8307629 (+)
G130967 NA other upstream 1336899 8188374 ~ 8189073 (+)
G130552 NA other upstream 2429320 7095053 ~ 7096652 (+)
G128757 NA other upstream 3199187 6326196 ~ 6326785 (+)
G132667 NA other downstream 42551 9568739 ~ 9569160 (+)
G133192 NA other downstream 633631 10159819 ~ 10161961 (+)
CI01000026_11075931_11078249 MDK, MDKA other downstream 1544580 11075784 ~ 11079080 (+)
CI01000026_11241496_11246081 NA other downstream 1718745 11241496 ~ 11246204 (+)
G133542 NA other downstream 1949929 11476117 ~ 11477544 (+)

Expression


Co-expression Network