G133373


Basic Information

Item Value
gene id G133373
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 10515420 ~ 10515648 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU151635
TTTTCTTAAATGAGACTGCCTCGATGATGTATGAAGCCTTCAAAGGGTGCAGCCCCTGAATTAGGACAGCCATTGTTGAAAAATCTCTCGGCTTCCGTATCCCGAACGAAGCGCGTTGATGGGCGTGCTCTTGCTCTTGCTCTGGGTGATGTGTGTGTGCACGCTTACCAGGGAGAAGTGCCTATACAAGGAATTCCACCGTTTATTACGTGATAAAGGACCATACTCC

Function

NR:

description
PREDICTED: TLR4 interactor with leucine rich repeats-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU151635 True 229 lncRNA 0.48 1 10515420 10515648

Neighbor

gene id symbol gene type direction distance location
CI01000026_10468478_10482863 LRP3 coding upstream 32465 10468478 ~ 10482955 (+)
CI01000026_10458602_10465979 GPATCH1 coding upstream 48907 10458602 ~ 10466513 (+)
CI01000026_10455059_10456945 CNEP1R1, CNEP1R1.L, TM188 coding upstream 57857 10455059 ~ 10457563 (+)
CI01000026_10453245_10454111 NA coding upstream 61244 10453125 ~ 10454176 (+)
CI01000026_10351923_10354175 CEBPG coding upstream 158725 10351403 ~ 10356695 (+)
CI01000026_10521984_10543018 RHPN2 coding downstream 6336 10521984 ~ 10543108 (+)
CI01000026_10547566_10588420 CEP89 coding downstream 31623 10547271 ~ 10589071 (+)
CI01000026_10634025_10634327 NA coding downstream 117806 10633454 ~ 10635525 (+)
CI01000026_10640494_10646504 BAT1, SLC7A9 coding downstream 124846 10640494 ~ 10646840 (+)
CI01000026_10651216_10652913 NA coding downstream 133895 10649543 ~ 10653754 (+)
G133344 NA non-coding upstream 128176 10387042 ~ 10387244 (+)
G133339 NA non-coding upstream 133662 10381554 ~ 10381758 (+)
G133338 NA non-coding upstream 133871 10381254 ~ 10381549 (+)
G133336 NA non-coding upstream 141465 10373398 ~ 10373955 (+)
G133383 NA non-coding downstream 37312 10552960 ~ 10628076 (+)
G133406 NA non-coding downstream 269144 10784792 ~ 10785562 (+)
G133420 NA non-coding downstream 370405 10886053 ~ 10895159 (+)
G133426 NA non-coding downstream 391827 10907475 ~ 10907675 (+)
G133442 NA non-coding downstream 603063 11118711 ~ 11119022 (+)
G133192 NA other upstream 353459 10159819 ~ 10161961 (+)
G132667 NA other upstream 946260 9568739 ~ 9569160 (+)
G131077 NA other upstream 2008633 8501408 ~ 8506787 (+)
CI01000026_08297901_08307596 CTRB1 other upstream 2216006 8297857 ~ 8307629 (+)
G130967 NA other upstream 2326347 8188374 ~ 8189073 (+)
CI01000026_11075931_11078249 MDK, MDKA other downstream 555120 11075784 ~ 11079080 (+)
CI01000026_11241496_11246081 NA other downstream 729285 11241496 ~ 11246204 (+)
G133542 NA other downstream 960469 11476117 ~ 11477544 (+)

Expression


Co-expression Network