G133528


Basic Information

Item Value
gene id G133528
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 11354162 ~ 11354451 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU151813
CTTCACTGTAAATGTCTTTGCAACACCTGGAAACTTCATCAGTCTAGTGATCTCCCCCAGATTAAACACAGACTTTGATGATCCCTTCTTGTCACTCTCTGGCACAGTGTGTATTTTGGTCTGTTTAGGGATGAAGTTCAACACCAACAGCAAAGAAACAAAACTCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU151813 True 168 lncRNA 0.42 2 11354162 11354451

Neighbor

gene id symbol gene type direction distance location
CI01000026_11298219_11305000 NA coding upstream 49149 11298219 ~ 11305013 (+)
CI01000026_11266022_11278889 NA coding upstream 75263 11266022 ~ 11278899 (+)
CI01000026_11262923_11264188 TNNI2A.4, TNNI2B.2, TNNI2B.1 coding upstream 89628 11261081 ~ 11264534 (+)
CI01000026_11241496_11246081 NA coding upstream 108081 11241496 ~ 11246204 (+)
CI01000026_11239339_11240254 TNNI2A.4, TNNI2B.2, TNNI2B.1 coding upstream 113729 11239339 ~ 11240433 (+)
CI01000026_11403059_11415298 PTPN5 coding downstream 48608 11403059 ~ 11415512 (+)
CI01000026_11436071_11446054 KIAA0232 coding downstream 81050 11435501 ~ 11446322 (+)
CI01000026_11456632_11473446 TBC1D14 coding downstream 102181 11456632 ~ 11473653 (+)
CI01000026_11483300_11485455 TADA2B coding downstream 128849 11483300 ~ 11486080 (+)
CI01000026_11497016_11677778 SORCS2 coding downstream 142565 11497016 ~ 11677778 (+)
G133530 NA non-coding upstream 4556 11349312 ~ 11349606 (+)
G133529 NA non-coding upstream 5238 11347963 ~ 11348924 (+)
G133523 NA non-coding upstream 11674 11340639 ~ 11342488 (+)
G133522 NA non-coding upstream 17331 11335470 ~ 11336831 (+)
G133521 NA non-coding upstream 20059 11333873 ~ 11334103 (+)
G133533 NA non-coding downstream 7365 11361816 ~ 11362227 (+)
G133512 NA non-coding downstream 14389 11368840 ~ 11369299 (+)
G133536 NA non-coding downstream 40593 11395044 ~ 11395244 (+)
G133542 NA non-coding downstream 121666 11476117 ~ 11477544 (+)
G133564 NA non-coding downstream 247751 11602202 ~ 11602886 (+)
CI01000026_11075931_11078249 MDK, MDKA other upstream 275082 11075784 ~ 11079080 (+)
G133192 NA other upstream 1192201 10159819 ~ 10161961 (+)
G132667 NA other upstream 1785002 9568739 ~ 9569160 (+)
G131077 NA other upstream 2847375 8501408 ~ 8506787 (+)

Expression


Co-expression Network