G134197


Basic Information

Item Value
gene id G134197
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 12143509 ~ 12143787 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU152613
GAAATTAAAGGGTTAGTTCACCCAAAAATTAAATTTCTGTCATTAAGTAGGCCTCCTCACCCTTGTGTTGTTCCAAACCGTTCATCTTTGGAACACAAATTAAGATATTTTTGATGATATCCAAGTTTTTTTTAATTCCCTATAGAAATCAACGTAATTGCTGTCATTCAAGGTCCAGAAAGGTATTAAAGACATTGTTAAAATGTCTGATTTCACATTGTTGTTTTGGGTGAACTAACCCTTTAAGGTTTTTGAGGAAAATATTCCAGGATTTTTCTC

Function

NR:

description
PREDICTED: constitutive coactivator of PPAR-gamma-like protein 2

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU152613 True 279 lncRNA 0.33 1 12143509 12143787

Neighbor

gene id symbol gene type direction distance location
CI01000026_12094316_12125431 NA coding upstream 17245 12094316 ~ 12126264 (+)
CI01000026_12074163_12076475 MNX1 coding upstream 65969 12073813 ~ 12077540 (+)
CI01000026_11862091_11976290 PTPRN2 coding upstream 167219 11862091 ~ 11976290 (+)
CI01000026_11809092_11810238 NA coding upstream 333098 11808462 ~ 11810411 (+)
CI01000026_11792044_11807684 NCAPG2 coding upstream 335235 11792044 ~ 11808274 (+)
CI01000026_12192269_12200366 NA coding downstream 47865 12191652 ~ 12200734 (+)
CI01000026_12203244_12209526 SHH, SHHA coding downstream 57571 12201358 ~ 12209698 (+)
CI01000026_12425699_12438163 NA coding downstream 280292 12424079 ~ 12438621 (+)
CI01000026_12486292_12534245 SCRIB coding downstream 342099 12485886 ~ 12534327 (+)
CI01000026_12551009_12554565 NA coding downstream 407222 12551009 ~ 12554565 (+)
G134120 NA non-coding upstream 111103 12005870 ~ 12032406 (+)
G134145 NA non-coding upstream 230077 11912221 ~ 11913432 (+)
G134141 NA non-coding upstream 251907 11861568 ~ 11891602 (+)
G133608 NA non-coding upstream 391334 11751165 ~ 11752175 (+)
G133596 NA non-coding upstream 409504 11733745 ~ 11734005 (+)
G134201 NA non-coding downstream 6732 12150519 ~ 12150775 (+)
G134215 NA non-coding downstream 51397 12195184 ~ 12195417 (+)
G134217 NA non-coding downstream 52714 12196501 ~ 12196758 (+)
G134218 NA non-coding downstream 53303 12197090 ~ 12197300 (+)
G134238 NA non-coding downstream 116160 12259947 ~ 12260177 (+)
G133542 NA other upstream 666602 11476117 ~ 11477544 (+)
CI01000026_11241496_11246081 NA other upstream 888436 11241496 ~ 11246204 (+)
CI01000026_11075931_11078249 MDK, MDKA other upstream 1064429 11075784 ~ 11079080 (+)
G133192 NA other upstream 1981548 10159819 ~ 10161961 (+)
G132667 NA other upstream 2574349 9568739 ~ 9569160 (+)

Expression


Co-expression Network