G134350


Basic Information

Item Value
gene id G134350
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 12609266 ~ 12609676 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU152773
AAGCGTGCCTGTAGAGTAGTCATGATATCGGCAATATTAGTGATGAAGAACTGAGAGAGTGCCTGAGGGCTACAGTAAGAGGCCAGTAGTAGCAGGACTCGGTCTATAAGACCCATGAGCATGGAGTTTGAAGGAACATCTTTGGCTTGAAATGACTGGTAGATAGAGCTGAGGAGAAGAACCTGTCTTTCCAATTGGGACTGGCGAGCAATATTTTGAAAGCAGGTCTGAAAGAGCTCTTCCATGATATGTTTTTTGTCCCGGCACAGAACTCTAGCCATGAGCTTCAATAACACAGGACTCTGAGACAGCTGCAGGGCCTCTAAA

Function

NR:

description
PREDICTED: uncharacterized protein LOC108239224

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU152773 True 327 lncRNA 0.46 2 12609266 12609676

Neighbor

gene id symbol gene type direction distance location
CI01000026_12582462_12589223 GAREM, GAREM1 coding upstream 19709 12582304 ~ 12589557 (+)
CI01000026_12562467_12570436 DPH2 coding upstream 38492 12562467 ~ 12570774 (+)
CI01000026_12558237_12560933 RGS9BP coding upstream 47648 12558237 ~ 12561618 (+)
CI01000026_12551009_12554565 NA coding upstream 54701 12551009 ~ 12554565 (+)
CI01000026_12486292_12534245 SCRIB coding upstream 74939 12485886 ~ 12534327 (+)
CI01000026_12653232_12657339 CHPF2 coding downstream 43396 12653072 ~ 12657836 (+)
CI01000026_12706512_12707086 NA coding downstream 95617 12705293 ~ 12707152 (+)
CI01000026_12867260_12871481 NA coding downstream 257535 12867211 ~ 12871720 (+)
CI01000026_12929788_12932668 HRH3 coding downstream 319963 12929639 ~ 12933391 (+)
CI01000026_12966022_12977066 ORC6 coding downstream 355920 12965596 ~ 12977588 (+)
G134348 NA non-coding upstream 3901 12604600 ~ 12605365 (+)
G134345 NA non-coding upstream 5085 12503262 ~ 12604181 (+)
G134306 NA non-coding upstream 11567 12595796 ~ 12597699 (+)
G134314 NA non-coding upstream 127796 12456629 ~ 12481470 (+)
G134356 NA non-coding downstream 7279 12616955 ~ 12617540 (+)
G134357 NA non-coding downstream 9765 12619441 ~ 12621548 (+)
G134359 NA non-coding downstream 12243 12621919 ~ 12622715 (+)
G134319 NA non-coding downstream 16153 12625829 ~ 12627728 (+)
G134326 NA non-coding downstream 18342 12628018 ~ 12628374 (+)
G133542 NA other upstream 1132359 11476117 ~ 11477544 (+)
CI01000026_11241496_11246081 NA other upstream 1354193 11241496 ~ 11246204 (+)
CI01000026_11075931_11078249 MDK, MDKA other upstream 1530186 11075784 ~ 11079080 (+)
G133192 NA other upstream 2447305 10159819 ~ 10161961 (+)
G132667 NA other upstream 3040106 9568739 ~ 9569160 (+)

Expression


Co-expression Network