G135886


Basic Information

Item Value
gene id G135886
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 14403897 ~ 14404114 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU154459
AAACAATCACTCGAGACCCTTTCAGCATTTTTTCAGCATAGTATCAACTCATTCAAGTGCCTGAGCATTTGAAGTGCTTGTCTTATAGGAAAATGTCACATGACATAGTACTGTTGGATCTTAGGTTAGTGTTGCCAAGTCCGCGGTTTTCCTGCGGAATTGGGCTACTTTTACACTGTTGCCGCGGGTTGTATTTCATGTCCGCGGGTTGAATCGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU154459 True 218 lncRNA 0.44 1 14403897 14404114

Neighbor

gene id symbol gene type direction distance location
CI01000026_14376741_14381102 NA coding downstream 21804 14376570 ~ 14382093 (-)
CI01000026_14156809_14170720 CDH11 coding downstream 233177 14156349 ~ 14170720 (-)
CI01000026_13744060_13791879 CDH8 coding downstream 612018 13744060 ~ 13791879 (-)
CI01000026_13299234_13300178 NA coding downstream 1102957 13298482 ~ 13300940 (-)
CI01000026_13082079_13210565 ITFG1 coding downstream 1193332 13082079 ~ 13210565 (-)
CI01000026_14680424_14682203 TK2 coding upstream 276245 14680359 ~ 14682203 (-)
CI01000026_14684215_14684738 NA coding upstream 280089 14684203 ~ 14685091 (-)
CI01000026_14697383_14715245 CMTM4 coding upstream 292929 14697043 ~ 14715245 (-)
CI01000026_14720591_14737569 DYNC1LI2 coding upstream 315702 14719816 ~ 14737569 (-)
CI01000026_14780225_14789500 NAE1 coding upstream 375974 14780088 ~ 14790709 (-)
G135771 NA non-coding downstream 68989 14334571 ~ 14334908 (-)
G135725 NA non-coding downstream 102654 14300775 ~ 14301243 (-)
G135633 NA non-coding downstream 178336 14225344 ~ 14225561 (-)
G135632 NA non-coding downstream 179445 14224159 ~ 14224452 (-)
G135631 NA non-coding downstream 180506 14223096 ~ 14223391 (-)
G135917 NA non-coding upstream 44492 14448606 ~ 14448839 (-)
G135927 NA non-coding upstream 58163 14462277 ~ 14462577 (-)
G136118 NA non-coding upstream 170352 14574466 ~ 14574723 (-)
G136107 NA non-coding upstream 172057 14576171 ~ 14579318 (-)
G136103 NA non-coding upstream 185816 14589930 ~ 14636003 (-)
G133802 NA other downstream 3096716 11301915 ~ 11307181 (-)
G133790 NA other downstream 3566292 10834015 ~ 10859589 (-)
CI01000026_10788054_10788652 CD59 other downstream 3613743 10787339 ~ 10789709 (-)
CI01000026_10347872_10351783 CEBPA other downstream 4054940 10347746 ~ 10351783 (-)
G132721 NA other downstream 4853253 9550030 ~ 9550644 (-)
G136110 NA other upstream 150803 14554917 ~ 14555436 (-)
CI01000026_16756776_16760261 RBPMS2A, RBPMS2B, RBPMS2 other upstream 2352615 16756729 ~ 16761341 (-)
G137667 NA other upstream 2402250 16806364 ~ 16808372 (-)
G137914 NA other upstream 2579137 16983251 ~ 16984352 (-)
G137967 NA other upstream 2664234 17068348 ~ 17069433 (-)

Expression


Co-expression Network