G137771


Basic Information

Item Value
gene id G137771
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 16792419 ~ 16792637 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU156495
ACTAACTACGTCATTACTTCAGGTTGAATGATTGTGATTGGCTAAGAAAAATAGACAAATTTGGTAATCTTCCACACATGGACAGATAGTCAGAAGCATATCTCCATTCGTCACGATGCTGACGAGGGGACCCTGGATTTAGGTACTGGATGTCCTTTTGGGTTCATGACATGGCGTCTGCTGGTCTCAAGCAGAGTGCCAGTTGTCCACCAGTACAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU156495 True 219 lncRNA 0.44 1 16792419 16792637

Neighbor

gene id symbol gene type direction distance location
CI01000026_16756776_16760261 RBPMS2A, RBPMS2B, RBPMS2 coding downstream 32158 16756729 ~ 16761341 (-)
CI01000026_16739750_16751270 CPEB1B coding downstream 41149 16739248 ~ 16751465 (-)
CI01000026_16645459_16698069 MTSS1L coding downstream 94350 16645264 ~ 16698069 (-)
CI01000026_16553812_16554906 NA coding downstream 236536 16553382 ~ 16555883 (-)
CI01000026_16432592_16456842 NA coding downstream 335577 16432527 ~ 16456842 (-)
CI01000026_16817010_16832208 SIN3AB coding upstream 23658 16816295 ~ 16832208 (-)
CI01000026_16959659_16962519 CDKN1CA coding upstream 166636 16959273 ~ 16963221 (-)
CI01000026_16988458_16994714 TRAF6 coding upstream 195179 16987816 ~ 16995104 (-)
CI01000026_17021405_17034147 MFGE8A coding upstream 227880 17020517 ~ 17034147 (-)
G137674 NA non-coding downstream 5399 16784325 ~ 16787020 (-)
G137678 NA non-coding downstream 8172 16783404 ~ 16784247 (-)
G137669 NA non-coding upstream 18874 16811511 ~ 16813504 (-)
G137776 NA non-coding upstream 52410 16845047 ~ 16845250 (-)
G137781 NA non-coding upstream 59688 16852325 ~ 16852683 (-)
G137782 NA non-coding upstream 61738 16854375 ~ 16854623 (-)
G137783 NA non-coding upstream 61988 16854625 ~ 16854857 (-)
G136110 NA other downstream 2236983 14554917 ~ 14555436 (-)
G133802 NA other downstream 5485238 11301915 ~ 11307181 (-)
G133790 NA other downstream 5954814 10834015 ~ 10859589 (-)
CI01000026_10788054_10788652 CD59 other downstream 6002265 10787339 ~ 10789709 (-)
G137667 NA other upstream 13727 16806364 ~ 16808372 (-)
G137914 NA other upstream 190614 16983251 ~ 16984352 (-)
G137967 NA other upstream 275711 17068348 ~ 17069433 (-)

Expression


Co-expression Network