CI01000027_00178291_00179467 (EXT1B, EXT1A, EXT1, EXTL1)


Basic Information

Item Value
gene id CI01000027_00178291_00179467
gene name EXT1B, EXT1A, EXT1, EXTL1
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 178289 ~ 179471 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000027_00178291_00179467.mRNA
ATCCCATCAACGGTTCGCTCCATCCATCAAGATCGCATCCTGTCTCTCCGCCAGCAGACGCAGTTCTTGTGGGAAGCGTACTTCTCTTCTGTGGAGAAAATTGTGCTCACTACATTGGAGATCATCCAGGACCGTGTATTGCAGCACAACGGCCGCAGTACACTGATGTGGAACCAGCTGCCAGGAGGGCTCTTCACCCTGCCACAATACTCCTCCTATCTGGGCGACTTCCCCTTCTTCTACGCCGTACTCG
>TU158098
ACAGATCCCATCAACGGTTCGCTCCATCCATCAAGATCGCATCCTGTCTCTCCGCCAGCAGACGCAGTTCTTGTGGGAAGCGTACTTCTCTTCTGTGGAGAAAATTGTGCTCACTACATTGGAGATCATCCAGGACCGTGTATTGCAGCACAACGGCCGCAGTACACTGATGTGGAACCAGCTGCCAGGAGGGCTCTTCACCCTGCCACAATACTCCTCCTATCTGGGCGACTTCCCCTTCTTCTACGCCGTACTCGGT

Function

symbol description
ext1a Predicted to enable N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity and glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity. Predicted to be involved in heparan sulfate proteoglycan biosynthetic process. Predicted to act upstream of or within protein glycosylation. Predicted to be integral component of endoplasmic reticulum membrane. Predicted to be active in Golgi apparatus. Is expressed in several structures, including brain; forebrain neural keel; neural plate; optic vesicle; and tail bud. Human ortholog(s) of this gene implicated in chondrosarcoma; hereditary multiple exostoses; and trichorhinophalangeal syndrome type II. Orthologous to human EXT1 (exostosin glycosyltransferase 1).
ext1b Predicted to enable N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity and glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity. Predicted to be involved in heparan sulfate proteoglycan biosynthetic process. Predicted to act upstream of or within protein glycosylation. Predicted to be integral component of endoplasmic reticulum membrane. Predicted to be active in Golgi apparatus. Is expressed in several structures, including axial mesoderm; brain; germ ring; pronephric duct; and tail bud. Human ortholog(s) of this gene implicated in chondrosarcoma; hereditary multiple exostoses; and trichorhinophalangeal syndrome type II. Orthologous to human EXT1 (exostosin glycosyltransferase 1).
ext1 Enables UDP-glycosyltransferase activity and protein dimerization activity. Involved in glycosaminoglycan biosynthetic process; heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process; and ossification. Located in Golgi apparatus and endoplasmic reticulum. Implicated in chondrosarcoma; hereditary multiple exostoses; and trichorhinophalangeal syndrome type II. Biomarker of chondrosarcoma.
extl1 Predicted to enable acetylglucosaminyltransferase activity and glucuronosyltransferase activity. Predicted to be involved in skeletal system development. Predicted to be located in endoplasmic reticulum membrane. Predicted to be active in Golgi apparatus.

GO:

id name namespace
GO:0005783 endoplasmic reticulum cellular_component

KEGG:

id description
K02366 EXT1; glucuronyl/N-acetylglucosaminyl transferase EXT1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000027_00178291_00179467.mRNA False 253 mRNA 0.54 2 178291 179467
TU158098 True 259 lncRNA 0.54 2 178289 179471

Neighbor

gene id symbol gene type direction distance location
CI01000027_00137910_00141799 NA coding downstream 35014 137292 ~ 144599 (-)
CI01000027_00131884_00132650 NA coding downstream 45641 131395 ~ 132650 (-)
CI01000027_00108990_00118237 NA coding downstream 59883 108119 ~ 118408 (-)
CI01000027_00078634_00087807 TAP1 coding downstream 89572 78492 ~ 88719 (-)
CI01000027_00060015_00076918 BRD2B, BRD2A, BRD2 coding downstream 101263 60015 ~ 77028 (-)
CI01000027_00332200_00343377 NA coding upstream 152515 331982 ~ 344039 (-)
CI01000027_00645077_00650763 SLC25A32B, SLC25A32 coding upstream 465527 644241 ~ 651285 (-)
CI01000027_00701871_00719591 COL28A1B coding upstream 522299 701766 ~ 719591 (-)
CI01000027_00742700_00758723 COL28A1B coding upstream 563164 742631 ~ 758723 (-)
CI01000027_00798826_00806532 ICA1 coding upstream 619219 798686 ~ 806532 (-)
G139138 NA non-coding downstream 32505 145381 ~ 145786 (-)
G139089 NA non-coding downstream 55786 121498 ~ 122505 (-)
G139111 NA non-coding downstream 96380 81630 ~ 81911 (-)
G139123 NA non-coding upstream 30265 209732 ~ 216101 (-)
G139154 NA non-coding upstream 59206 238673 ~ 239396 (-)
G139155 NA non-coding upstream 59973 239440 ~ 239676 (-)
G139158 NA non-coding upstream 61377 240844 ~ 241126 (-)
G139160 NA non-coding upstream 69656 249123 ~ 249388 (-)
G139117 NA other upstream 54745 234212 ~ 237579 (-)
CI01000027_01241417_01245177 NA other upstream 1065168 1240478 ~ 1246267 (-)
CI01000027_01303308_01319462 NR2F5, NR2F1, NR2F1.L, NR2F2 other upstream 1122567 1302034 ~ 1321178 (-)
CI01000027_02119227_02124423 NA other upstream 1942663 2119131 ~ 2125142 (-)
CI01000027_02226447_02227499 NA other upstream 2047158 2225781 ~ 2227499 (-)

Expression


Co-expression Network