CI01000027_01519267_01519711 (AFP4, APOA2)


Basic Information

Item Value
gene id CI01000027_01519267_01519711
gene name AFP4, APOA2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 1519267 ~ 1519776 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000027_01519267_01519711.mRNA
GCTCTGAGTCAGTATCTCTGGTCAAGAGAGACGCTCCTGCTGAGCTGGACCAGATCGCCAAGTACTTCCAGGACCTTGTGGACAATCTGAAGAACGTTGAGGGCCCTGAGCTGGCCAACAAGGCCAATGCTTACCTCGAGCAGAGCAGAGCCCAGTTCCAGCCCATGATTGAGAAGCTCCAGGAGCAGCTGAAGCCCCTCTCCAGCAACATTGAAGAGCACATCAAGCCTCTGGCCGCCTCCGTCCAGGCTCAGGTCGCCCCCCTGGCCGGCATGGTCCAGACCCACGTTGAAGACGTCCTCAAGTTTGTGGCTGACAAGACCAAAGCCATCCTGCCGCCTCAGTAAACCCAAAGAATCACTGTTGCTTATAGTTTTCTTTCATATTGGTCTCTTTATGTATATTTAAAATA

Function

symbol description
apoa2 Acts upstream of or within chordate embryonic development; epiboly involved in gastrulation with mouth forming second; and nuclear division. Is expressed in liver and yolk syncytial layer.
afp4 Acts upstream of or within dorsal convergence and epiboly. Is expressed in gut; intestinal bulb; intestine; liver; and yolk syncytial layer.

NR:

description
embryogenesis regulator

GO:

id name namespace
GO:0034372 very-low-density lipoprotein particle remodeling biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000027_01519267_01519711.mRNA True 412 mRNA 0.53 2 1519267 1519776

Neighbor

gene id symbol gene type direction distance location
CI01000027_01413155_01416305 NA coding upstream 101609 1413101 ~ 1417658 (+)
CI01000027_01176638_01185141 NA coding upstream 333960 1175836 ~ 1185307 (+)
CI01000027_01162273_01168513 NA coding upstream 350610 1162273 ~ 1168657 (+)
CI01000027_01153787_01158632 NA coding upstream 360266 1153787 ~ 1159001 (+)
CI01000027_01148208_01150893 NA coding upstream 368350 1148058 ~ 1150917 (+)
CI01000027_01543335_01543974 NA coding downstream 23559 1543335 ~ 1544229 (+)
CI01000027_01546280_01571152 NTRK1 coding downstream 25967 1545743 ~ 1571220 (+)
CI01000027_01572250_01574108 NA coding downstream 52117 1571893 ~ 1574410 (+)
CI01000027_01767031_01767683 NA coding downstream 246831 1766607 ~ 1767863 (+)
CI01000027_01811625_01827803 RGL2 coding downstream 289981 1804199 ~ 1828182 (+)
G138430 NA non-coding upstream 56448 1461181 ~ 1462819 (+)
G138455 NA non-coding upstream 58811 1460240 ~ 1460456 (+)
G138454 NA non-coding upstream 59283 1459767 ~ 1459984 (+)
G138453 NA non-coding upstream 59697 1459295 ~ 1459570 (+)
G138415 NA non-coding upstream 140413 1378106 ~ 1378854 (+)
G138474 NA non-coding downstream 9945 1529721 ~ 1529926 (+)
G138475 NA non-coding downstream 13194 1532970 ~ 1533422 (+)
G138491 NA non-coding downstream 62257 1582033 ~ 1582333 (+)
G138494 NA non-coding downstream 73499 1593275 ~ 1596468 (+)
G138508 NA non-coding downstream 113048 1632824 ~ 1647449 (+)
G138436 NA other upstream 11451 1506961 ~ 1507816 (+)
G138290 NA other upstream 520086 995970 ~ 999181 (+)
G138247 NA other upstream 649692 855388 ~ 893121 (+)
G138238 NA other upstream 687584 829774 ~ 831683 (+)
CI01000027_00391159_00499309 CSMD3 other upstream 1090591 390683 ~ 499760 (+)
G138515 NA other downstream 144632 1664408 ~ 1676860 (+)
G138915 NA other downstream 1964611 3484387 ~ 3486647 (+)
G138953 NA other downstream 1982296 3502072 ~ 3520065 (+)
G140436 NA other downstream 3217622 4737398 ~ 4774262 (+)
G140440 NA other downstream 3260641 4780417 ~ 4785660 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_011026 afp4 coding NC_007127.7 CM002900.2 45912647 ~ 45917683 (-)