CI01000027_07375781_07378401 (ITGA8)


Basic Information

Item Value
gene id CI01000027_07375781_07378401
gene name ITGA8
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 7375781 ~ 7378421 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000027_07375781_07378401.mRNA
CTCTGACAATGGACCTGCAGTTGGATTGGCTGAAGCAGCGTGGAGCAGTTAAGCGAATCTTGTTCATGGACACTCACCAGCACCAAAGAACCCAACAGTTAGTTCTGGGTCAAGGGGACCGCCAACATTGCCACAACTACTCTGTTTACCTGCGGGATGAGGGAGAGTTTAGGGATAAACTGAGCCCTATCAGCGTGGCACTGAACTACAGTCTGGACCAGAACTCCCCTCCACCTGGCCTACAGCTGCGGCCCATTTTAGATCACTATAGCAAGACCTTCCACCATGAGCAGGCAAACATCCTGTTGGATTGTGGGGAAGACAACATGTGCATCCCAGATCTCAAACTTTCTGCTAAAATGGACCGGACAGAACTTCTAATCGGGGATGACAACTTGCTTATGTTGACCATTAATGCCGCCAATGAGGGAGAGGGGGCGTACGAGGCGGAGCTTCACGTGACCCTCCCACCAGAGGCGGATTATATTGGTGTGGAGCGCAGACGTGAGGTAAACAACATTACCCTCTATCTTTTTTTACATATACTGTATGTGTGTGACATATCGCTTTGTATGTGCTTATGTGGGTTTCGGTAGCTGATTGGATGTAGAAGATA

Function

symbol description
itga8 Acts upstream of or within cilium assembly and embryonic viscerocranium morphogenesis. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be part of integrin complex. Is expressed in hair cell; head; inner ear; neuromast hair cell; and pharyngeal arch. Human ortholog(s) of this gene implicated in end stage renal disease; ovarian cancer; renal agenesis; and schizophrenia. Orthologous to human ITGA8 (integrin subunit alpha 8).

GO:

id name namespace
GO:0008305 integrin complex cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000027_07375781_07378401.mRNA True 616 mRNA 0.49 4 7375781 7378421

Neighbor

gene id symbol gene type direction distance location
CI01000027_07292677_07331000 FAM188A coding upstream 44749 7292677 ~ 7331032 (+)
CI01000027_07216718_07225808 NA coding upstream 149210 7215768 ~ 7226571 (+)
CI01000027_07142789_07157141 NA coding upstream 217794 7142315 ~ 7157987 (+)
CI01000027_07055665_07057014 NA coding upstream 318527 7055117 ~ 7057254 (+)
CI01000027_06951132_06956691 GLIPR2, GLIPR2L coding upstream 418939 6951132 ~ 6957767 (+)
CI01000027_07432479_07451012 FAM171A1 coding downstream 54058 7432479 ~ 7452012 (+)
CI01000027_07455850_07459062 NMT2, NMT1 coding downstream 77429 7455850 ~ 7459062 (+)
CI01000027_07469157_07471720 NA coding downstream 90543 7468964 ~ 7471999 (+)
CI01000027_07529488_07537870 DCST2 coding downstream 151067 7529488 ~ 7539111 (+)
CI01000027_07541256_07541975 NA coding downstream 162835 7541256 ~ 7542152 (+)
G141355 NA non-coding upstream 41644 7333909 ~ 7334137 (+)
G141354 NA non-coding upstream 42149 7333422 ~ 7333632 (+)
G141321 NA non-coding upstream 46686 7305684 ~ 7329095 (+)
G141255 NA non-coding upstream 180287 7195275 ~ 7195494 (+)
G141254 NA non-coding upstream 182154 7193425 ~ 7193627 (+)
G141364 NA non-coding downstream 122736 7501157 ~ 7501487 (+)
G141330 NA non-coding downstream 123645 7502066 ~ 7514879 (+)
G141378 NA non-coding downstream 151378 7529799 ~ 7530002 (+)
G141380 NA non-coding downstream 157696 7536117 ~ 7536333 (+)
G142360 NA non-coding downstream 338699 7717120 ~ 7722230 (+)
G141082 NA other upstream 474858 6898411 ~ 6900923 (+)
CI01000027_06706050_06708485 NA other upstream 665149 6705983 ~ 6708513 (+)
G141052 NA other upstream 1104181 6271367 ~ 6271600 (+)
G140924 NA other upstream 1410455 5963206 ~ 5965326 (+)
CI01000027_07947743_07951397 NA other downstream 572282 7947657 ~ 7951942 (+)
CI01000027_08026500_08029412 ENSAB, ENSA other downstream 647976 8025788 ~ 8032041 (+)
CI01000027_08255251_08264629 NA other downstream 879916 8255073 ~ 8264897 (+)
G143033 NA other downstream 2350394 9728815 ~ 9729551 (+)

Expression


Co-expression Network