G138106


Basic Information

Item Value
gene id G138106
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 218123 ~ 218344 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU156890
CCAAGTTTGGTGAAATTATCTCATTCTGTTTTAGTAAAAGTGGCCACGCCCACTTTGAACATTTTGGAGTCCCGTCATGGACATGAATCGAAATTTGTACTTTTTTTATATAATTATTGACAACCAGACTCCAGAGAATCTTTTTGCACTGGTTTGGTTCCGATTGGACAAAAAAAACCTAGGACTAGTTCGCAAAAGAAGGTTTTTCAAAAAATCCAAAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU156890 True 222 lncRNA 0.36 1 218123 218344

Neighbor

gene id symbol gene type direction distance location
CI01000027_00122108_00124986 NA coding upstream 93137 122024 ~ 124986 (+)
CI01000027_00089337_00092919 NA coding upstream 125038 88779 ~ 93085 (+)
CI01000027_00000579_00037786 NA coding upstream 180271 579 ~ 37852 (+)
CI01000027_00229612_00237058 RAD21A, RAD21B, RAD21 coding downstream 10661 229005 ~ 237759 (+)
CI01000027_00238851_00240657 NA coding downstream 20507 238851 ~ 240991 (+)
CI01000027_00250077_00273130 EIF3H coding downstream 31412 249756 ~ 273130 (+)
CI01000027_00365674_00371897 CSMD3 coding downstream 146646 364990 ~ 371996 (+)
CI01000027_00391159_00499309 CSMD3 coding downstream 172339 390683 ~ 499760 (+)
G138104 NA non-coding upstream 1123 216288 ~ 217000 (+)
G138094 NA non-coding upstream 20409 196777 ~ 197714 (+)
G138093 NA non-coding upstream 26694 191180 ~ 191429 (+)
G138090 NA non-coding upstream 31850 186050 ~ 186273 (+)
G138077 NA non-coding upstream 65328 152288 ~ 152795 (+)
G138107 NA non-coding downstream 43 218387 ~ 218630 (+)
G138114 NA non-coding downstream 25672 244016 ~ 245308 (+)
G138115 NA non-coding downstream 27539 245883 ~ 247582 (+)
G138155 NA non-coding downstream 425277 643621 ~ 645451 (+)
G138030 NA other upstream 117866 39146 ~ 100257 (+)
G138238 NA other downstream 611430 829774 ~ 831683 (+)
G138247 NA other downstream 637044 855388 ~ 893121 (+)
G138290 NA other downstream 777626 995970 ~ 999181 (+)
G138436 NA other downstream 1288617 1506961 ~ 1507816 (+)

Expression


Co-expression Network