G138312


Basic Information

Item Value
gene id G138312
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 1015044 ~ 1015245 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU157139
TATGCACTTATGCACCCCCATACCATCAGAGATGCTGGCTTTTGAACTGAATGCTGATAACACGCTGGAAGGTCTCCCTTCTCTTTAGCCCGGAGGACACGGCGTCCGTGATTTCCAACAAGAATGTCAAATTTGGACTCGTCTGACCATAGAACACTTTTCCACTTTGAAACAGTCCATTTTAAATGAGCCTTGGCCCACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU157139 True 202 lncRNA 0.47 1 1015044 1015245

Neighbor

gene id symbol gene type direction distance location
CI01000027_00980123_00987611 NA coding upstream 27160 979155 ~ 987884 (+)
CI01000027_00949578_00953698 NA coding upstream 60763 948721 ~ 954281 (+)
CI01000027_00909268_00918831 NA coding upstream 95831 908513 ~ 919213 (+)
CI01000027_00779517_00795032 NA coding upstream 219655 778954 ~ 795389 (+)
CI01000027_00765527_00776450 MIOS coding upstream 238281 765467 ~ 776763 (+)
CI01000027_01033975_01037549 NA coding downstream 17658 1032903 ~ 1037922 (+)
CI01000027_01045587_01050470 MEX3A coding downstream 28147 1043392 ~ 1050863 (+)
CI01000027_01089832_01104918 NA coding downstream 74587 1089832 ~ 1104980 (+)
CI01000027_01119958_01123077 NA coding downstream 104185 1119430 ~ 1123099 (+)
CI01000027_01134221_01143363 NA coding downstream 116912 1132157 ~ 1143526 (+)
G138311 NA non-coding upstream 1890 1012877 ~ 1013154 (+)
G138309 NA non-coding upstream 10698 1003993 ~ 1004346 (+)
G138300 NA non-coding upstream 30345 984457 ~ 984699 (+)
G138277 NA non-coding upstream 45877 968941 ~ 969167 (+)
G138267 NA non-coding upstream 80546 933743 ~ 934498 (+)
G138289 NA non-coding downstream 6276 1021521 ~ 1024940 (+)
CI01000027_01176638_01185141 NA non-coding downstream 164665 1175836 ~ 1185307 (+)
G138350 NA non-coding downstream 199203 1214448 ~ 1214747 (+)
G138355 NA non-coding downstream 203408 1218653 ~ 1218878 (+)
G138357 NA non-coding downstream 205627 1220872 ~ 1225465 (+)
G138290 NA other upstream 15863 995970 ~ 999181 (+)
G138247 NA other upstream 145469 855388 ~ 893121 (+)
G138238 NA other upstream 183361 829774 ~ 831683 (+)
CI01000027_00391159_00499309 CSMD3 other upstream 586368 390683 ~ 499760 (+)
G138057 NA other upstream 918317 93559 ~ 96727 (+)
G138436 NA other downstream 491716 1506961 ~ 1507816 (+)
G138515 NA other downstream 649163 1664408 ~ 1676860 (+)
G138915 NA other downstream 2469142 3484387 ~ 3486647 (+)
G138953 NA other downstream 2486827 3502072 ~ 3520065 (+)
G140436 NA other downstream 3722153 4737398 ~ 4774262 (+)

Expression


Co-expression Network