G139406


Basic Information

Item Value
gene id G139406
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 1160392 ~ 1160644 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU158410
GTGAAAAGGTTCAGTACTGAAGACACCTGGTGCCACACTCTAATACGCTAATTAACTCAAAACACCTGCAAAGGCCTTTAAATGGTCTCTCAGTCTAGTTCTGTAGGCTACACAATCATGGGGAAGACTGCTGACTTGACAGTTGTCCAAAAGACGACCATTGACACCTTGCACAAGGAGGGCAAGACACAAAAGGTCATTGCAAAAGAGGGTGGCTGTTCACAGAGCTCTGTGTCCAAGCACATTAATAGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU158410 True 253 lncRNA 0.45 1 1160392 1160644

Neighbor

gene id symbol gene type direction distance location
CI01000027_01111716_01114630 NA coding downstream 44832 1111678 ~ 1115560 (-)
CI01000027_01082314_01087880 UBQL4, XDRP1, UBQLN1, UBQLN4 coding downstream 71788 1081949 ~ 1088604 (-)
CI01000027_01078554_01079951 MAPIP, ROBLD3-PS1, LAMTOR2.L, LAMTOR2.S, LAMTOR2 coding downstream 80441 1078436 ~ 1079951 (-)
CI01000027_01072444_01076227 RAB25B, RAB25, RAA2A, RAB25A coding downstream 84165 1072015 ~ 1076227 (-)
CI01000027_01059994_01067301 RAB11A, RAB11AL, RAB25, RB11A coding downstream 93031 1058928 ~ 1067361 (-)
CI01000027_01198110_01199285 RPZ4 coding upstream 36846 1197490 ~ 1200933 (-)
CI01000027_01204940_01206121 RPZ5 coding upstream 43825 1204469 ~ 1206319 (-)
CI01000027_01232167_01232844 NA coding upstream 70913 1231557 ~ 1234381 (-)
CI01000027_01241417_01245177 NA coding upstream 80693 1240478 ~ 1246267 (-)
CI01000027_01249889_01250572 RPZ coding upstream 88818 1249462 ~ 1250579 (-)
G139405 NA non-coding downstream 127 1160046 ~ 1160265 (-)
G139382 NA non-coding downstream 51516 1108550 ~ 1108876 (-)
G139373 NA non-coding downstream 116013 1044041 ~ 1044379 (-)
G139364 NA non-coding downstream 130517 1028269 ~ 1029875 (-)
G139409 NA non-coding upstream 49602 1210246 ~ 1210464 (-)
G139410 NA non-coding upstream 50741 1211385 ~ 1211600 (-)
G139412 NA non-coding upstream 56226 1216870 ~ 1217069 (-)
G139424 NA non-coding upstream 81159 1241803 ~ 1243713 (-)
G139117 NA other downstream 922813 234212 ~ 237579 (-)
CI01000027_00131884_00132650 NA other downstream 1026590 131395 ~ 132650 (-)
CI01000027_00108990_00118237 NA other downstream 1042089 108119 ~ 118408 (-)
CI01000027_01303308_01319462 NR2F5, NR2F1, NR2F1.L, NR2F2 other upstream 141390 1302034 ~ 1321178 (-)
CI01000027_02119227_02124423 NA other upstream 961486 2119131 ~ 2125142 (-)
CI01000027_02226447_02227499 NA other upstream 1065981 2225781 ~ 2227499 (-)
G140118 NA other upstream 2340890 3509352 ~ 3584679 (-)

Expression


Co-expression Network