G138298


Basic Information

Item Value
gene id G138298
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 1235859 ~ 1236549 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU157125
TGGATTGTTTTCCCCCCCGGTGGGCGTGGTTTTCAGATTATGACGCGTGTCGCTCTGTCTCTATAGTAATATTTCATTGCATTGGAAAATCTATCTATCTATCTATCTATCATGTCTAAAAGTGGAGTGATACAAACTGCATGAAACTTCATGTATCCAGTTCCTACAACTAATAGTTCCTGTTTCCATCTTGTGCACTAAAACTCACACATGAGGAAGTTGGCTGCACAAACTCTTTTGTCATACTGACAGACATATTCTTTTTCCTTTTATTTCAATGGGCAAAACTGTGTATATGATGAGTTTGTCACGCAGGACTCTTGATTCTCTGCTCTCATTGCTAGAGAGTGATTCACTTCACATCGAGTGAGGTTACTCCTAAAATTGAGGACATTAAATGTAAATGCACGTTCCAAATTGGAGACAGGCCCGACAATCAGATGGCAGCAAAGACACAGACAAGGATTAAAGAAGTAAGAGATTTTACTGACATTTAGTTCATCTTTAGTTCATCCATCTATCTATCTATCTATCTATCTATCTATAATCATTCCTATGATTAGAAACTTGTGTTAGAGCATTTTAGTATGGTCCTGGTGTATGACTATGGTTTATGTATGCTTATAGCCACAAGATGTCACTTTAGCGCATAATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU157125 True 655 lncRNA 0.38 2 1235859 1236549

Neighbor

gene id symbol gene type direction distance location
CI01000027_01176638_01185141 NA coding upstream 50552 1175836 ~ 1185307 (+)
CI01000027_01162273_01168513 NA coding upstream 67202 1162273 ~ 1168657 (+)
CI01000027_01153787_01158632 NA coding upstream 76858 1153787 ~ 1159001 (+)
CI01000027_01148208_01150893 NA coding upstream 84942 1148058 ~ 1150917 (+)
CI01000027_01134221_01143363 NA coding upstream 92333 1132157 ~ 1143526 (+)
CI01000027_01413155_01416305 NA coding downstream 176552 1413101 ~ 1417658 (+)
CI01000027_01519267_01519711 AFP4, APOA2 coding downstream 282718 1519267 ~ 1519776 (+)
CI01000027_01543335_01543974 NA coding downstream 306786 1543335 ~ 1544229 (+)
CI01000027_01546280_01571152 NTRK1 coding downstream 309194 1545743 ~ 1571220 (+)
CI01000027_01572250_01574108 NA coding downstream 335344 1571893 ~ 1574410 (+)
G138357 NA non-coding upstream 10394 1220872 ~ 1225465 (+)
G138355 NA non-coding upstream 16981 1218653 ~ 1218878 (+)
G138350 NA non-coding upstream 21112 1214448 ~ 1214747 (+)
G138289 NA non-coding upstream 210919 1021521 ~ 1024940 (+)
G138360 NA non-coding downstream 1200 1237749 ~ 1238319 (+)
G138282 NA non-coding downstream 10174 1246723 ~ 1250610 (+)
G138376 NA non-coding downstream 58905 1295454 ~ 1295822 (+)
G138407 NA non-coding downstream 116155 1352704 ~ 1352908 (+)
G138415 NA non-coding downstream 141557 1378106 ~ 1378854 (+)
G138290 NA other upstream 236678 995970 ~ 999181 (+)
G138247 NA other upstream 366284 855388 ~ 893121 (+)
G138238 NA other upstream 404176 829774 ~ 831683 (+)
CI01000027_00391159_00499309 CSMD3 other upstream 807183 390683 ~ 499760 (+)
G138057 NA other upstream 1139132 93559 ~ 96727 (+)
G138436 NA other downstream 270412 1506961 ~ 1507816 (+)
G138515 NA other downstream 427859 1664408 ~ 1676860 (+)
G138915 NA other downstream 2247838 3484387 ~ 3486647 (+)
G138953 NA other downstream 2265523 3502072 ~ 3520065 (+)
G140436 NA other downstream 3500849 4737398 ~ 4774262 (+)

Expression


Co-expression Network