G138656


Basic Information

Item Value
gene id G138656
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 2154569 ~ 2155082 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU157542
CCCAGAGAAGCGGTGTCGTTGAGGAAAACAAATGATCCAGATCCGTTCATCTGTTTTATTATTTTATTCCTGTATATCGACTTGAATTTCTTCATAAGGACAGATTTCACGGCGAGTATGTATTTAGTTGAGAATAGTTGACTTCAGCAGAGCTTTAGATAAAGTTTATATCAGTTTAGAGCTTTAAAACCGAATCATGTGGCATCTGAACATTATTGCTCAAATAATTTTATCGATTTAAACAGTATTTCTGCTTTATTCCTGTAAACTGGACTGTTAAGGTCAATTTACCACAGATGGTATCTAAATGTTTTGTTTATGCTTCATGAACCCCGTTCTTACTTGTTTTCTTTGCAAGAGACACACTGGTTGTGTGTACAGAACTTAGTGTACTGCCTAGTTAGACAGACTTTTAAGGGCGTGCAGCATGTTTGAAGTGCATAGGTTTGCATCTTTGTAAGCATCATAGCAGTTTGCAGCATTTTTGGGCATCAAAGGTGCATTGGAAAAAGGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU157542 True 514 lncRNA 0.37 1 2154569 2155082

Neighbor

gene id symbol gene type direction distance location
CI01000027_02125080_02146147 NA coding upstream 8067 2124834 ~ 2146502 (+)
CI01000027_02106256_02118045 NA coding upstream 36071 2106185 ~ 2118498 (+)
CI01000027_02083444_02085743 NA coding upstream 68789 2083143 ~ 2085780 (+)
CI01000027_02059709_02072254 GAPDHS, G3PT, GAPDH coding upstream 82164 2059377 ~ 2072405 (+)
CI01000027_02040721_02047487 NA coding upstream 107003 2040621 ~ 2047566 (+)
CI01000027_02156853_02161914 RBM42 coding downstream 1771 2156853 ~ 2162004 (+)
CI01000027_02194222_02218628 ARHGAP30, ARHGAP33 coding downstream 39140 2194222 ~ 2219765 (+)
CI01000027_02230213_02233471 NA coding downstream 75131 2230213 ~ 2233491 (+)
CI01000027_02234729_02237937 NA coding downstream 79647 2234729 ~ 2238114 (+)
CI01000027_02242334_02250969 DCAF13 coding downstream 87252 2242334 ~ 2251188 (+)
G138649 NA non-coding upstream 828 2149329 ~ 2153741 (+)
G138693 NA non-coding upstream 34776 2119198 ~ 2119793 (+)
G138672 NA non-coding upstream 72517 2077080 ~ 2082052 (+)
G138686 NA non-coding upstream 101634 2052580 ~ 2052935 (+)
G138627 NA non-coding upstream 188963 1965332 ~ 1965606 (+)
CI01000027_02254195_02308930 NA non-coding downstream 98466 2253903 ~ 2310086 (+)
G138669 NA non-coding downstream 116287 2271369 ~ 2324059 (+)
G138675 NA non-coding downstream 171810 2326892 ~ 2329110 (+)
G138683 NA non-coding downstream 176907 2331989 ~ 2335650 (+)
G138651 NA non-coding downstream 186122 2341204 ~ 2345765 (+)
G138515 NA other upstream 477709 1664408 ~ 1676860 (+)
G138436 NA other upstream 646753 1506961 ~ 1507816 (+)
G138290 NA other upstream 1155388 995970 ~ 999181 (+)
G138247 NA other upstream 1284994 855388 ~ 893121 (+)
G138238 NA other upstream 1322886 829774 ~ 831683 (+)
G138915 NA other downstream 1329305 3484387 ~ 3486647 (+)
G138953 NA other downstream 1346990 3502072 ~ 3520065 (+)
G140436 NA other downstream 2582316 4737398 ~ 4774262 (+)
G140440 NA other downstream 2625335 4780417 ~ 4785660 (+)
CI01000027_05050310_05055447 NA other downstream 2893841 5050310 ~ 5055755 (+)

Expression


Co-expression Network