G138763


Basic Information

Item Value
gene id G138763
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 2612593 ~ 2612822 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU157665
ATTTATTTTGGCCTTCAAAACAGCCTTTCACTACCACTATAAAGCTTGGTTGTGTTAGTCTGAAAGAAGATACTCATATACACCTAGGATGGTTTAAGGGTGAGTAAATCGTGGGATAATTTTCATTTTTGGGTGAACTATCTCTTTAAGAACCACATAGACATACAGTACAGTACTGTTGAAAAGTCAGTTTTTAAGAAATTAATACTTTTATTCAGCAAAAACACACT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU157665 True 230 lncRNA 0.33 1 2612593 2612822

Neighbor

gene id symbol gene type direction distance location
CI01000027_02530086_02589227 NA coding upstream 23117 2529638 ~ 2589476 (+)
CI01000027_02492454_02508459 NA coding upstream 103991 2492077 ~ 2508602 (+)
CI01000027_02455787_02458435 DCSTAMP coding upstream 153549 2455153 ~ 2459044 (+)
CI01000027_02429134_02451902 RIMS2A, RIMS2 coding upstream 160058 2427563 ~ 2452535 (+)
CI01000027_02419674_02422700 NA coding upstream 189465 2419633 ~ 2423128 (+)
CI01000027_02895512_02924151 NA coding downstream 282690 2895512 ~ 2924197 (+)
CI01000027_02941870_02946290 OXR1 coding downstream 329048 2941870 ~ 2948777 (+)
CI01000027_02981155_02982628 NA coding downstream 368189 2981011 ~ 2982885 (+)
CI01000027_02991231_02994560 PSMA2 coding downstream 378409 2991231 ~ 2994717 (+)
CI01000027_02995394_03005981 ATAD2 coding downstream 382572 2995394 ~ 3005997 (+)
G138762 NA non-coding upstream 403 2611906 ~ 2612190 (+)
G138761 NA non-coding upstream 3133 2609167 ~ 2609460 (+)
G138760 NA non-coding upstream 3944 2608426 ~ 2608649 (+)
G138759 NA non-coding upstream 4954 2607409 ~ 2607639 (+)
G138758 NA non-coding upstream 5881 2606512 ~ 2606712 (+)
G138764 NA non-coding downstream 251 2613073 ~ 2613529 (+)
G138765 NA non-coding downstream 1673 2614495 ~ 2614729 (+)
G138766 NA non-coding downstream 3181 2616003 ~ 2616299 (+)
G138767 NA non-coding downstream 4712 2617534 ~ 2617779 (+)
G138768 NA non-coding downstream 5362 2618184 ~ 2618438 (+)
G138515 NA other upstream 935733 1664408 ~ 1676860 (+)
G138436 NA other upstream 1104777 1506961 ~ 1507816 (+)
G138290 NA other upstream 1613412 995970 ~ 999181 (+)
G138247 NA other upstream 1743018 855388 ~ 893121 (+)
G138238 NA other upstream 1780910 829774 ~ 831683 (+)
G138915 NA other downstream 871565 3484387 ~ 3486647 (+)
G138953 NA other downstream 889250 3502072 ~ 3520065 (+)
G140436 NA other downstream 2124576 4737398 ~ 4774262 (+)
G140440 NA other downstream 2167595 4780417 ~ 4785660 (+)
CI01000027_05050310_05055447 NA other downstream 2436101 5050310 ~ 5055755 (+)

Expression


Co-expression Network