G139929


Basic Information

Item Value
gene id G139929
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 2929308 ~ 2929766 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU159010
TAAAAAGGAAAATACAGTTAAGTGCAACATGTGCAGTGCAAGTCTGTCATATAGGCTATATAAAATTATAATGAGAACATTATAATCGTGTGCTTGGGACATGGCTTTTAATGGTAAAACTTTTGTTTTTGTAATCAGGCTCTCAAAAATTATATACAAATTTGGATTTAGATTTATTGACCAATATATCGGTCATTGGCTTTCAAATATGAAGAATTATCGGTTATCGGTATCGGCCAAAATGTTCATATCGGTGGATCCCTGGTAAAAGTTAAACAATTAAAAACTTTTACACATTAATAATATAGCATCTGTACGGCTTCATTCGCACTACCTCATCATGACTGGACTTTCTTAAAGGGTTAGTTTAACCAAAAATAAAAATACAGTCATTAATTACTCACCCTCATGTCATTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU159010 True 417 lncRNA 0.32 2 2929308 2929766

Neighbor

gene id symbol gene type direction distance location
CI01000027_02840202_02843749 NA coding downstream 83617 2839482 ~ 2845691 (-)
CI01000027_02742168_02773304 NA coding downstream 156004 2742168 ~ 2773304 (-)
CI01000027_02460101_02470648 DPYS coding downstream 458503 2459265 ~ 2470805 (-)
CI01000027_02314898_02317288 NA coding downstream 612000 2314551 ~ 2317308 (-)
CI01000027_02240021_02241453 NA coding downstream 687855 2239996 ~ 2241453 (-)
CI01000027_02950348_02954214 SQLE, SQLEA coding upstream 20340 2950106 ~ 2954214 (-)
CI01000027_02961909_02972343 RNF144B coding upstream 31998 2961764 ~ 2972343 (-)
CI01000027_02984235_02987159 CCDC127, CCDC127A coding upstream 54241 2984007 ~ 2987159 (-)
CI01000027_02989304_02990854 NA coding upstream 59523 2989289 ~ 2990854 (-)
CI01000027_03035114_03099542 ADAM22 coding upstream 105348 3035114 ~ 3099542 (-)
G139845 NA non-coding downstream 73708 2788349 ~ 2855600 (-)
G139743 NA non-coding downstream 191237 2737348 ~ 2738071 (-)
G139839 NA non-coding downstream 194991 2733645 ~ 2734317 (-)
G139807 NA non-coding downstream 233871 2695226 ~ 2695437 (-)
G139806 NA non-coding downstream 234122 2694912 ~ 2695186 (-)
G139883 NA non-coding upstream 17565 2947331 ~ 2947916 (-)
G139939 NA non-coding upstream 182502 3112268 ~ 3114186 (-)
CI01000027_03117518_03132307 RUNDC3B non-coding upstream 186608 3115633 ~ 3132307 (-)
G139972 NA non-coding upstream 208041 3137807 ~ 3138013 (-)
G139967 NA non-coding upstream 228629 3158395 ~ 3159374 (-)
CI01000027_02226447_02227499 NA other downstream 701283 2225781 ~ 2227499 (-)
CI01000027_02119227_02124423 NA other downstream 803280 2119131 ~ 2125142 (-)
CI01000027_01303308_01319462 NR2F5, NR2F1, NR2F1.L, NR2F2 other downstream 1609147 1302034 ~ 1321178 (-)
CI01000027_01241417_01245177 NA other downstream 1682331 1240478 ~ 1246267 (-)
G139117 NA other downstream 2691729 234212 ~ 237579 (-)
G140118 NA other upstream 571768 3509352 ~ 3584679 (-)
CI01000027_03787377_03788902 NA other upstream 857612 3787377 ~ 3790279 (-)
CI01000027_03922380_03931033 NA other upstream 992630 3922242 ~ 3931033 (-)
G141481 NA other upstream 1442481 4372247 ~ 4412810 (-)
G141488 NA other upstream 1577709 4507475 ~ 4508971 (-)

Expression


Co-expression Network