G138831


Basic Information

Item Value
gene id G138831
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 3122874 ~ 3123166 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU157737
AATACAAAAGCACTTCAGGAGTGCGTGGGCGATATGACCAAATTCTTATTTCACCATATGAGAAATTTTATTTCATGATAACGACATATATCACGATATAGTTATTTTGTGTTATTTTATCTCATTTCTGTTATTAAAAATAAGAACAATAGGACAAATACAATTTAACAAAAATGTCAATTAAACAAATTAAGTTTCAGGTACAATAGGTTTATTTAACATGTAGTTAGAATTAGTACAAAAAACTATAATCAAATGTAAAAATAAAATTCACTGTATGACTCAAATATAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU157737 True 293 lncRNA 0.25 1 3122874 3123166

Neighbor

gene id symbol gene type direction distance location
CI01000027_03110196_03113083 NA coding upstream 9465 3109207 ~ 3113409 (+)
CI01000027_03014464_03027710 E430025E21RIK, STRUMPELLIN, KIAA0196 coding upstream 95012 3013856 ~ 3027862 (+)
CI01000027_03008262_03011156 NA coding upstream 110879 3008262 ~ 3011995 (+)
CI01000027_02995394_03005981 ATAD2 coding upstream 116877 2995394 ~ 3005997 (+)
CI01000027_02991231_02994560 PSMA2 coding upstream 128157 2991231 ~ 2994717 (+)
CI01000027_03142352_03156415 NA coding downstream 18944 3142110 ~ 3157077 (+)
CI01000027_03159177_03163102 NA coding downstream 35803 3158969 ~ 3163325 (+)
CI01000027_03174793_03181990 NA coding downstream 51627 3174793 ~ 3182308 (+)
CI01000027_03202787_03208051 MTX1A coding downstream 79621 3202787 ~ 3208301 (+)
CI01000027_03212432_03231800 THBS3, THBS3A coding downstream 89266 3212432 ~ 3231862 (+)
G138830 NA non-coding upstream 169 3122291 ~ 3122705 (+)
G138828 NA non-coding upstream 6215 3116370 ~ 3116659 (+)
G138817 NA non-coding upstream 133941 2988688 ~ 2988933 (+)
G138802 NA non-coding upstream 152066 2963817 ~ 2970808 (+)
CI01000027_02941870_02946290 OXR1 non-coding upstream 174097 2941870 ~ 2948777 (+)
G138832 NA non-coding downstream 1631 3124797 ~ 3125029 (+)
G138833 NA non-coding downstream 2283 3125449 ~ 3125675 (+)
G138834 NA non-coding downstream 3877 3127043 ~ 3127275 (+)
G138835 NA non-coding downstream 4189 3127355 ~ 3127942 (+)
G138836 NA non-coding downstream 6293 3129459 ~ 3136867 (+)
G138515 NA other upstream 1446014 1664408 ~ 1676860 (+)
G138436 NA other upstream 1615058 1506961 ~ 1507816 (+)
G138290 NA other upstream 2123693 995970 ~ 999181 (+)
G138247 NA other upstream 2253299 855388 ~ 893121 (+)
G138238 NA other upstream 2291191 829774 ~ 831683 (+)
G138915 NA other downstream 361221 3484387 ~ 3486647 (+)
G138953 NA other downstream 378906 3502072 ~ 3520065 (+)
G140436 NA other downstream 1614232 4737398 ~ 4774262 (+)
G140440 NA other downstream 1657251 4780417 ~ 4785660 (+)
CI01000027_05050310_05055447 NA other downstream 1925757 5050310 ~ 5055755 (+)

Expression


Co-expression Network