G138835



Basic Information


Item Value
gene id G138835
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 3127355 ~ 3127942 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU157741
CAGAACTACAGCCCCCTCCTCATAAAACCTCCTGACAAATAAACATAAGACAGATCTTTAACACACAAAACTGATGAAGAACAATTAGCAGCACCTTTATATTTCCATGATTTTGTAAATAATTAAAAAAAAATTCAGGCAAACCGTTTTTCCATTGTTCCCACCCTCAAACTTGCATCAAACTCACAACAAAGCAATGTTTTGAAAGAACTGCAGAGCCTTCAGGAAGATAACCTATAAATGGCTGACTTTTAGTTGTCTCTGCATATTAAACTGGTATACAAGGAAGAATTATTGATGACACAATGCATTTTTGTCAACTTAATATTCTTACGTTTTTTGCCATATGGTGCTGCTTTTATTTTGGTGAAGTCACTATGTTTAAATAATCACTGTTGTGGAGAGGCTGACAACAGAGACTCATAAAAAGATTTTATCACAATCAGCCTGCAATAAAAAAATGAGAGTGTCAGTGTGCGTGTCTGTGAGAGCTGCATAAAGAAAAAGTACCTTGTAGTTTTGAAGTCTCTCAGAGCTGCAGAGATGTATTCAGACAAACGCTTCTCCATTAACGCCACTCTAATCCAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU157741 True 588 lncRNA 0.36 1 3127355 3127942
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000027_03110196_03113083 NA coding upstream 13946 3109207 ~ 3113409 (+)
CI01000027_03014464_03027710 E430025E21RIK, STRUMPELLIN, KIAA0196 coding upstream 99493 3013856 ~ 3027862 (+)
CI01000027_03008262_03011156 NA coding upstream 115360 3008262 ~ 3011995 (+)
CI01000027_02995394_03005981 ATAD2 coding upstream 121358 2995394 ~ 3005997 (+)
CI01000027_02991231_02994560 PSMA2 coding upstream 132638 2991231 ~ 2994717 (+)
CI01000027_03142352_03156415 NA coding downstream 14168 3142110 ~ 3157077 (+)
CI01000027_03159177_03163102 NA coding downstream 31027 3158969 ~ 3163325 (+)
CI01000027_03174793_03181990 NA coding downstream 46851 3174793 ~ 3182308 (+)
CI01000027_03202787_03208051 MTX1A coding downstream 74845 3202787 ~ 3208301 (+)
CI01000027_03212432_03231800 THBS3, THBS3A coding downstream 84490 3212432 ~ 3231862 (+)
G138834 NA non-coding upstream 80 3127043 ~ 3127275 (+)
G138833 NA non-coding upstream 1680 3125449 ~ 3125675 (+)
G138832 NA non-coding upstream 2326 3124797 ~ 3125029 (+)
G138831 NA non-coding upstream 4189 3122874 ~ 3123166 (+)
G138830 NA non-coding upstream 4650 3122291 ~ 3122705 (+)
G138836 NA non-coding downstream 1517 3129459 ~ 3136867 (+)
G138859 NA non-coding downstream 63678 3191620 ~ 3191938 (+)
G138888 NA non-coding downstream 120536 3248478 ~ 3248706 (+)
G138892 NA non-coding downstream 126988 3254930 ~ 3255207 (+)
G138884 NA non-coding downstream 181888 3309830 ~ 3314832 (+)
G138515 NA other upstream 1450495 1664408 ~ 1676860 (+)
G138436 NA other upstream 1619539 1506961 ~ 1507816 (+)
G138290 NA other upstream 2128174 995970 ~ 999181 (+)
G138247 NA other upstream 2257780 855388 ~ 893121 (+)
G138238 NA other upstream 2295672 829774 ~ 831683 (+)
G138915 NA other downstream 356445 3484387 ~ 3486647 (+)
G138953 NA other downstream 374130 3502072 ~ 3520065 (+)
G140436 NA other downstream 1609456 4737398 ~ 4774262 (+)
G140440 NA other downstream 1652475 4780417 ~ 4785660 (+)
CI01000027_05050310_05055447 NA other downstream 1920981 5050310 ~ 5055755 (+)

Expression


G138835 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

G138835 Expression in each Bioproject

Bar chart with 17 bars.
G138835 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network